Incidental Mutation 'R6632:Mcoln3'
ID 525202
Institutional Source Beutler Lab
Gene Symbol Mcoln3
Ensembl Gene ENSMUSG00000036853
Gene Name mucolipin 3
Synonyms varitint-waddler, Va, 6720490O21Rik, TRPML3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 146117450-146141806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 146128187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 161 (H161Y)
Ref Sequence ENSEMBL: ENSMUSP00000038801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039450] [ENSMUST00000140214]
AlphaFold Q8R4F0
Predicted Effect probably benign
Transcript: ENSMUST00000039450
AA Change: H161Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038801
Gene: ENSMUSG00000036853
AA Change: H161Y

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Pfam:PKD_channel 360 508 3.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140214
SMART Domains Protein: ENSMUSP00000115655
Gene: ENSMUSG00000036853

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 63 82 N/A INTRINSIC
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Heterozygotes show normal/diluted/white hair patches, circling, hyperactivity, deafness, and reduced fertility. Homozygotes are white with small patches of color and show severe behavioral abnormalities, poor postnatal viability and are nearly infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,281,067 S758P possibly damaging Het
Abca3 C G 17: 24,384,470 D545E probably benign Het
Akap9 T A 5: 4,013,842 probably null Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arpp21 G A 9: 112,127,356 Q518* probably null Het
Atp9b G A 18: 80,808,649 R410W probably damaging Het
Cacna2d3 T C 14: 28,905,265 *265W probably null Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cep164 T C 9: 45,779,790 K1231E possibly damaging Het
Cnot1 A G 8: 95,773,267 probably benign Het
Cpne2 T C 8: 94,554,955 V206A probably benign Het
Dchs1 A G 7: 105,761,878 Y1647H probably damaging Het
Dnaaf5 A G 5: 139,170,333 T590A probably benign Het
Eif4g1 A T 16: 20,685,520 I1068F probably damaging Het
Ephb4 A T 5: 137,366,587 K639N probably damaging Het
Gcc2 A G 10: 58,270,049 probably null Het
Gm35315 A C 5: 110,079,263 Y103* probably null Het
Hsd17b4 A G 18: 50,179,102 K578R possibly damaging Het
Ice2 T C 9: 69,428,452 S906P probably benign Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1b A T 2: 40,725,442 W3650R probably benign Het
Mphosph10 A T 7: 64,385,819 M368K probably damaging Het
Msh2 A C 17: 87,712,666 K567Q possibly damaging Het
N4bp3 T C 11: 51,643,949 E429G possibly damaging Het
Nrxn3 G A 12: 89,193,154 A17T probably damaging Het
Olfr1459 T A 19: 13,146,188 Y157F probably benign Het
Olfr171 T C 16: 19,625,023 T26A probably benign Het
P4ha2 G T 11: 54,117,648 R227L probably benign Het
Pfkfb4 G A 9: 109,009,562 probably null Het
Ror1 A G 4: 100,442,106 N892S probably benign Het
Scn9a G T 2: 66,483,502 D1957E probably benign Het
Sec24a A T 11: 51,713,649 Y713* probably null Het
Serpinb1b T A 13: 33,087,455 F70I probably damaging Het
Setdb1 T C 3: 95,324,149 Y1284C probably damaging Het
Suco A T 1: 161,828,240 M1030K possibly damaging Het
Syne1 A T 10: 5,215,667 probably null Het
Other mutations in Mcoln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mcoln3 APN 3 146133928 missense probably damaging 1.00
IGL01106:Mcoln3 APN 3 146137264 missense probably benign 0.01
IGL01712:Mcoln3 APN 3 146128264 unclassified probably benign
IGL02115:Mcoln3 APN 3 146137301 missense probably damaging 0.99
IGL02116:Mcoln3 APN 3 146133909 missense probably benign 0.29
P4717OSA:Mcoln3 UTSW 3 146124749 missense probably damaging 0.99
R0463:Mcoln3 UTSW 3 146140576 nonsense probably null
R1981:Mcoln3 UTSW 3 146140590 nonsense probably null
R2056:Mcoln3 UTSW 3 146128224 missense probably benign 0.01
R3000:Mcoln3 UTSW 3 146133907 missense possibly damaging 0.62
R4366:Mcoln3 UTSW 3 146140492 missense possibly damaging 0.76
R4667:Mcoln3 UTSW 3 146131204 missense probably benign 0.01
R4950:Mcoln3 UTSW 3 146139519 missense probably damaging 0.96
R5457:Mcoln3 UTSW 3 146128122 missense probably benign 0.00
R6302:Mcoln3 UTSW 3 146124772 missense probably benign 0.00
R6353:Mcoln3 UTSW 3 146131154 missense probably damaging 0.99
R6915:Mcoln3 UTSW 3 146137256 critical splice acceptor site probably null
R7790:Mcoln3 UTSW 3 146139492 missense probably damaging 1.00
R7838:Mcoln3 UTSW 3 146139475 missense probably damaging 1.00
R7861:Mcoln3 UTSW 3 146124791 missense possibly damaging 0.95
R8348:Mcoln3 UTSW 3 146131219 missense probably damaging 1.00
R8509:Mcoln3 UTSW 3 146124892 missense probably benign 0.00
R8708:Mcoln3 UTSW 3 146140521 nonsense probably null
R8838:Mcoln3 UTSW 3 146139371 missense probably damaging 1.00
R8861:Mcoln3 UTSW 3 146139404 missense probably damaging 1.00
R8981:Mcoln3 UTSW 3 146121799 missense probably benign
Z1176:Mcoln3 UTSW 3 146140466 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTGAATGTCTGCACCCCG -3'
(R):5'- AGTTCTTCCTATGCCATGAGGGTAC -3'

Sequencing Primer
(F):5'- AGGGAGACATGGCCAGC -3'
(R):5'- ATGCCATGAGGGTACTGTCCATC -3'
Posted On 2018-06-22