Incidental Mutation 'R6632:Gm35315'
ID 525211
Institutional Source Beutler Lab
Gene Symbol Gm35315
Ensembl Gene ENSMUSG00000109771
Gene Name predicted gene, 35315
Synonyms Gm20090
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110224001-110241292 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 110227129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 103 (Y103*)
Ref Sequence ENSEMBL: ENSMUSP00000147534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210052] [ENSMUST00000211397]
AlphaFold A0A1B0GRI2
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209865
Predicted Effect probably null
Transcript: ENSMUST00000210052
AA Change: Y103*
Predicted Effect probably benign
Transcript: ENSMUST00000211397
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,429,186 (GRCm39) S758P possibly damaging Het
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cnot1 A G 8: 96,499,895 (GRCm39) probably benign Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Dnaaf5 A G 5: 139,156,088 (GRCm39) T590A probably benign Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Hsd17b4 A G 18: 50,312,169 (GRCm39) K578R possibly damaging Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Mphosph10 A T 7: 64,035,567 (GRCm39) M368K probably damaging Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Suco A T 1: 161,655,809 (GRCm39) M1030K possibly damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in Gm35315
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6103:Gm35315 UTSW 5 110,226,137 (GRCm39) missense probably damaging 0.97
R6219:Gm35315 UTSW 5 110,226,410 (GRCm39) missense probably benign 0.23
R6429:Gm35315 UTSW 5 110,226,525 (GRCm39) missense possibly damaging 0.67
R6436:Gm35315 UTSW 5 110,226,578 (GRCm39) missense probably benign
R6482:Gm35315 UTSW 5 110,225,955 (GRCm39) missense possibly damaging 0.92
R7313:Gm35315 UTSW 5 110,227,091 (GRCm39) missense probably benign
R8699:Gm35315 UTSW 5 110,228,392 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGTGTTGCTTTATGTACTCGGA -3'
(R):5'- TAATGAAGGCGAAACCATGAATGT -3'

Sequencing Primer
(F):5'- GGATATGCAAAGGCCTTACCACATTG -3'
(R):5'- GCGAAACCATGAATGTAAACAAAATG -3'
Posted On 2018-06-22