Incidental Mutation 'R6632:Ephb4'
ID 525213
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, Myk1, Tyro11
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6632 (G1)
Quality Score 202.009
Status Validated
Chromosome 5
Chromosomal Location 137350109-137378669 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 137366587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 639 (K639N)
Ref Sequence ENSEMBL: ENSMUSP00000106683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably damaging
Transcript: ENSMUST00000061244
AA Change: K639N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: K639N

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111054
AA Change: K639N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: K639N

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111055
AA Change: K648N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: K648N

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144296
AA Change: K639N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: K639N

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166239
AA Change: K639N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: K639N

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,281,067 S758P possibly damaging Het
Abca3 C G 17: 24,384,470 D545E probably benign Het
Akap9 T A 5: 4,013,842 probably null Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arpp21 G A 9: 112,127,356 Q518* probably null Het
Atp9b G A 18: 80,808,649 R410W probably damaging Het
Cacna2d3 T C 14: 28,905,265 *265W probably null Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cep164 T C 9: 45,779,790 K1231E possibly damaging Het
Cnot1 A G 8: 95,773,267 probably benign Het
Cpne2 T C 8: 94,554,955 V206A probably benign Het
Dchs1 A G 7: 105,761,878 Y1647H probably damaging Het
Dnaaf5 A G 5: 139,170,333 T590A probably benign Het
Eif4g1 A T 16: 20,685,520 I1068F probably damaging Het
Gcc2 A G 10: 58,270,049 probably null Het
Gm35315 A C 5: 110,079,263 Y103* probably null Het
Hsd17b4 A G 18: 50,179,102 K578R possibly damaging Het
Ice2 T C 9: 69,428,452 S906P probably benign Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1b A T 2: 40,725,442 W3650R probably benign Het
Mcoln3 C T 3: 146,128,187 H161Y probably benign Het
Mphosph10 A T 7: 64,385,819 M368K probably damaging Het
Msh2 A C 17: 87,712,666 K567Q possibly damaging Het
N4bp3 T C 11: 51,643,949 E429G possibly damaging Het
Nrxn3 G A 12: 89,193,154 A17T probably damaging Het
Olfr1459 T A 19: 13,146,188 Y157F probably benign Het
Olfr171 T C 16: 19,625,023 T26A probably benign Het
P4ha2 G T 11: 54,117,648 R227L probably benign Het
Pfkfb4 G A 9: 109,009,562 probably null Het
Ror1 A G 4: 100,442,106 N892S probably benign Het
Scn9a G T 2: 66,483,502 D1957E probably benign Het
Sec24a A T 11: 51,713,649 Y713* probably null Het
Serpinb1b T A 13: 33,087,455 F70I probably damaging Het
Setdb1 T C 3: 95,324,149 Y1284C probably damaging Het
Suco A T 1: 161,828,240 M1030K possibly damaging Het
Syne1 A T 10: 5,215,667 probably null Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0599:Ephb4 UTSW 5 137369855 missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137360416 missense probably benign 0.00
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137361274 missense probably benign 0.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137357855 missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137370805 missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137354562 missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137363267 missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137363302 missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTGCTATCACATGCATATAC -3'
(R):5'- GTTCTCCATGAATTCCGTGAGG -3'

Sequencing Primer
(F):5'- AATGTGCGTACATGCTCGC -3'
(R):5'- GGATCATAACCGGCACACTGTTG -3'
Posted On 2018-06-22