Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:Dnaaf5'

525215

Institutional Source

Beutler Lab

Gene Symbol

Dnaaf5

Ensembl Gene

ENSMUSG00000025857

Gene Name

dynein, axonemal assembly factor 5

Synonyms

Heatr2

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.909) question?

Stock #

R6632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139150223-139186510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139170333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 590 (T590A)

Ref Sequence

ENSEMBL: ENSMUSP00000026975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026975] [ENSMUST00000196441]

AlphaFold

B9EJR8

Predicted Effect

probably benign
Transcript: ENSMUST00000026975
AA Change: T590A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000026975
Gene: ENSMUSG00000025857
AA Change: T590A

Domain	Start	End	E-Value	Type
low complexity region	2	32	N/A	INTRINSIC
low complexity region	43	59	N/A	INTRINSIC
low complexity region	73	83	N/A	INTRINSIC
low complexity region	91	153	N/A	INTRINSIC
low complexity region	162	175	N/A	INTRINSIC
Pfam:Vac14_Fab1_bd	673	770	2.4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127542

Predicted Effect

probably benign
Transcript: ENSMUST00000196441
AA Change: T295A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000142924
Gene: ENSMUSG00000025857
AA Change: T295A

Domain	Start	End	E-Value	Type
Pfam:Vac14_Fab1_bd	378	475	4.1e-5	PFAM
Pfam:HEAT	447	477	1.7e-3	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,281,067	S758P	possibly damaging	Het
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akap9	T	A	5: 4,013,842		probably null	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cep164	T	C	9: 45,779,790	K1231E	possibly damaging	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gcc2	A	G	10: 58,270,049		probably null	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Hsd17b4	A	G	18: 50,179,102	K578R	possibly damaging	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Pfkfb4	G	A	9: 109,009,562		probably null	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Setdb1	T	C	3: 95,324,149	Y1284C	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in Dnaaf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Dnaaf5	APN	5	139177946	missense	probably benign	0.19
IGL00730:Dnaaf5	APN	5	139151668	critical splice donor site	probably null
IGL01468:Dnaaf5	APN	5	139151480	splice site	probably null
IGL02106:Dnaaf5	APN	5	139151513	missense	probably damaging	1.00
IGL02273:Dnaaf5	APN	5	139177916	nonsense	probably null
IGL02514:Dnaaf5	APN	5	139174117	splice site	probably benign
IGL02572:Dnaaf5	APN	5	139184629	missense	probably benign	0.00
IGL02699:Dnaaf5	APN	5	139153350	splice site	probably benign
PIT4142001:Dnaaf5	UTSW	5	139185518	missense	possibly damaging	0.91
PIT4283001:Dnaaf5	UTSW	5	139166162	missense	probably benign	0.26
R0458:Dnaaf5	UTSW	5	139161878	missense	possibly damaging	0.47
R2060:Dnaaf5	UTSW	5	139178003	missense	probably damaging	1.00
R2162:Dnaaf5	UTSW	5	139181565	missense	possibly damaging	0.46
R3833:Dnaaf5	UTSW	5	139181565	missense	possibly damaging	0.46
R3944:Dnaaf5	UTSW	5	139152924	start gained	probably benign
R4438:Dnaaf5	UTSW	5	139163392	missense	probably damaging	1.00
R4534:Dnaaf5	UTSW	5	139151527	nonsense	probably null
R4576:Dnaaf5	UTSW	5	139185639	missense	probably damaging	0.98
R4581:Dnaaf5	UTSW	5	139184685	missense	probably damaging	1.00
R4715:Dnaaf5	UTSW	5	139178000	missense	probably damaging	0.99
R4791:Dnaaf5	UTSW	5	139184650	missense	possibly damaging	0.56
R4868:Dnaaf5	UTSW	5	139170186	missense	probably benign	0.01
R5011:Dnaaf5	UTSW	5	139163257	missense	probably damaging	1.00
R5074:Dnaaf5	UTSW	5	139174207	missense	probably damaging	1.00
R5137:Dnaaf5	UTSW	5	139181460	missense	probably damaging	1.00
R5215:Dnaaf5	UTSW	5	139161877	missense	probably benign	0.00
R5309:Dnaaf5	UTSW	5	139152862	missense	probably damaging	0.99
R5312:Dnaaf5	UTSW	5	139152862	missense	probably damaging	0.99
R6863:Dnaaf5	UTSW	5	139151596	missense	probably damaging	0.96
R7292:Dnaaf5	UTSW	5	139150317	missense	unknown
R7439:Dnaaf5	UTSW	5	139166113	missense	probably damaging	1.00
R7571:Dnaaf5	UTSW	5	139170208	missense	possibly damaging	0.73
R7679:Dnaaf5	UTSW	5	139150637	missense	unknown
R7706:Dnaaf5	UTSW	5	139152841	missense	probably damaging	1.00
R7867:Dnaaf5	UTSW	5	139161810	missense	probably damaging	1.00
R8191:Dnaaf5	UTSW	5	139181495	missense	probably benign	0.06
R8354:Dnaaf5	UTSW	5	139161859	frame shift	probably null
R8355:Dnaaf5	UTSW	5	139161859	frame shift	probably null
R8990:Dnaaf5	UTSW	5	139170196	missense	probably damaging	1.00
R9178:Dnaaf5	UTSW	5	139152897	missense	probably damaging	1.00
R9447:Dnaaf5	UTSW	5	139177988	missense	probably damaging	0.96
R9646:Dnaaf5	UTSW	5	139166077	missense	probably benign	0.00
R9649:Dnaaf5	UTSW	5	139174154	missense	probably benign	0.00
X0020:Dnaaf5	UTSW	5	139163320	missense	probably damaging	0.99
Z1177:Dnaaf5	UTSW	5	139177975	missense	probably damaging	1.00
Z1177:Dnaaf5	UTSW	5	139185542	missense	probably benign	0.04
Z1177:Dnaaf5	UTSW	5	139185585	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTTGTAGGCCCAGAAGACC -3'
(R):5'- CACTGTAAACCAGACGGAGC -3'

Sequencing Primer
(F):5'- ACCATGGACACACTGGCTGAG -3'
(R):5'- TTCTCAAGGCTTACCGTGGAAGAC -3'

Posted On

2018-06-22