Incidental Mutation 'R6632:Dnaaf5'
ID 525215
Institutional Source Beutler Lab
Gene Symbol Dnaaf5
Ensembl Gene ENSMUSG00000025857
Gene Name dynein, axonemal assembly factor 5
Synonyms Heatr2
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.901) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 139135978-139172265 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139156088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 590 (T590A)
Ref Sequence ENSEMBL: ENSMUSP00000026975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026975] [ENSMUST00000196441]
AlphaFold B9EJR8
Predicted Effect probably benign
Transcript: ENSMUST00000026975
AA Change: T590A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026975
Gene: ENSMUSG00000025857
AA Change: T590A

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 91 153 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
Pfam:Vac14_Fab1_bd 673 770 2.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127542
Predicted Effect probably benign
Transcript: ENSMUST00000196441
AA Change: T295A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142924
Gene: ENSMUSG00000025857
AA Change: T295A

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 378 475 4.1e-5 PFAM
Pfam:HEAT 447 477 1.7e-3 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,429,186 (GRCm39) S758P possibly damaging Het
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cnot1 A G 8: 96,499,895 (GRCm39) probably benign Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Gm35315 A C 5: 110,227,129 (GRCm39) Y103* probably null Het
Hsd17b4 A G 18: 50,312,169 (GRCm39) K578R possibly damaging Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Mphosph10 A T 7: 64,035,567 (GRCm39) M368K probably damaging Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Suco A T 1: 161,655,809 (GRCm39) M1030K possibly damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in Dnaaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dnaaf5 APN 5 139,163,701 (GRCm39) missense probably benign 0.19
IGL00730:Dnaaf5 APN 5 139,137,423 (GRCm39) critical splice donor site probably null
IGL01468:Dnaaf5 APN 5 139,137,235 (GRCm39) splice site probably null
IGL02106:Dnaaf5 APN 5 139,137,268 (GRCm39) missense probably damaging 1.00
IGL02273:Dnaaf5 APN 5 139,163,671 (GRCm39) nonsense probably null
IGL02514:Dnaaf5 APN 5 139,159,872 (GRCm39) splice site probably benign
IGL02572:Dnaaf5 APN 5 139,170,384 (GRCm39) missense probably benign 0.00
IGL02699:Dnaaf5 APN 5 139,139,105 (GRCm39) splice site probably benign
PIT4142001:Dnaaf5 UTSW 5 139,171,273 (GRCm39) missense possibly damaging 0.91
PIT4283001:Dnaaf5 UTSW 5 139,151,917 (GRCm39) missense probably benign 0.26
R0458:Dnaaf5 UTSW 5 139,147,633 (GRCm39) missense possibly damaging 0.47
R2060:Dnaaf5 UTSW 5 139,163,758 (GRCm39) missense probably damaging 1.00
R2162:Dnaaf5 UTSW 5 139,167,320 (GRCm39) missense possibly damaging 0.46
R3833:Dnaaf5 UTSW 5 139,167,320 (GRCm39) missense possibly damaging 0.46
R3944:Dnaaf5 UTSW 5 139,138,679 (GRCm39) start gained probably benign
R4438:Dnaaf5 UTSW 5 139,149,147 (GRCm39) missense probably damaging 1.00
R4534:Dnaaf5 UTSW 5 139,137,282 (GRCm39) nonsense probably null
R4576:Dnaaf5 UTSW 5 139,171,394 (GRCm39) missense probably damaging 0.98
R4581:Dnaaf5 UTSW 5 139,170,440 (GRCm39) missense probably damaging 1.00
R4715:Dnaaf5 UTSW 5 139,163,755 (GRCm39) missense probably damaging 0.99
R4791:Dnaaf5 UTSW 5 139,170,405 (GRCm39) missense possibly damaging 0.56
R4868:Dnaaf5 UTSW 5 139,155,941 (GRCm39) missense probably benign 0.01
R5011:Dnaaf5 UTSW 5 139,149,012 (GRCm39) missense probably damaging 1.00
R5074:Dnaaf5 UTSW 5 139,159,962 (GRCm39) missense probably damaging 1.00
R5137:Dnaaf5 UTSW 5 139,167,215 (GRCm39) missense probably damaging 1.00
R5215:Dnaaf5 UTSW 5 139,147,632 (GRCm39) missense probably benign 0.00
R5309:Dnaaf5 UTSW 5 139,138,617 (GRCm39) missense probably damaging 0.99
R5312:Dnaaf5 UTSW 5 139,138,617 (GRCm39) missense probably damaging 0.99
R6863:Dnaaf5 UTSW 5 139,137,351 (GRCm39) missense probably damaging 0.96
R7292:Dnaaf5 UTSW 5 139,136,072 (GRCm39) missense unknown
R7439:Dnaaf5 UTSW 5 139,151,868 (GRCm39) missense probably damaging 1.00
R7571:Dnaaf5 UTSW 5 139,155,963 (GRCm39) missense possibly damaging 0.73
R7679:Dnaaf5 UTSW 5 139,136,392 (GRCm39) missense unknown
R7706:Dnaaf5 UTSW 5 139,138,596 (GRCm39) missense probably damaging 1.00
R7867:Dnaaf5 UTSW 5 139,147,565 (GRCm39) missense probably damaging 1.00
R8191:Dnaaf5 UTSW 5 139,167,250 (GRCm39) missense probably benign 0.06
R8354:Dnaaf5 UTSW 5 139,147,614 (GRCm39) frame shift probably null
R8355:Dnaaf5 UTSW 5 139,147,614 (GRCm39) frame shift probably null
R8990:Dnaaf5 UTSW 5 139,155,951 (GRCm39) missense probably damaging 1.00
R9178:Dnaaf5 UTSW 5 139,138,652 (GRCm39) missense probably damaging 1.00
R9447:Dnaaf5 UTSW 5 139,163,743 (GRCm39) missense probably damaging 0.96
R9646:Dnaaf5 UTSW 5 139,151,832 (GRCm39) missense probably benign 0.00
R9649:Dnaaf5 UTSW 5 139,159,909 (GRCm39) missense probably benign 0.00
X0020:Dnaaf5 UTSW 5 139,149,075 (GRCm39) missense probably damaging 0.99
Z1177:Dnaaf5 UTSW 5 139,171,340 (GRCm39) missense probably damaging 1.00
Z1177:Dnaaf5 UTSW 5 139,171,297 (GRCm39) missense probably benign 0.04
Z1177:Dnaaf5 UTSW 5 139,163,730 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTTGTAGGCCCAGAAGACC -3'
(R):5'- CACTGTAAACCAGACGGAGC -3'

Sequencing Primer
(F):5'- ACCATGGACACACTGGCTGAG -3'
(R):5'- TTCTCAAGGCTTACCGTGGAAGAC -3'
Posted On 2018-06-22