Incidental Mutation 'R6632:Mphosph10'
ID 525219
Institutional Source Beutler Lab
Gene Symbol Mphosph10
Ensembl Gene ENSMUSG00000030521
Gene Name M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Synonyms 2810453H10Rik, 5730405D16Rik
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 64026289-64041984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 64035567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 368 (M368K)
Ref Sequence ENSEMBL: ENSMUSP00000032735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735]
AlphaFold Q810V0
Predicted Effect probably damaging
Transcript: ENSMUST00000032735
AA Change: M368K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521
AA Change: M368K

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is phosphorylated during mitosis. The protein localizes to the nucleolus during interphase and to the chromosomes during M phase. The protein associates with the U3 small nucleolar ribonucleoprotein 60-80S complexes and may be involved in pre-rRNA processing. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,429,186 (GRCm39) S758P possibly damaging Het
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cnot1 A G 8: 96,499,895 (GRCm39) probably benign Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Dnaaf5 A G 5: 139,156,088 (GRCm39) T590A probably benign Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Gm35315 A C 5: 110,227,129 (GRCm39) Y103* probably null Het
Hsd17b4 A G 18: 50,312,169 (GRCm39) K578R possibly damaging Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Suco A T 1: 161,655,809 (GRCm39) M1030K possibly damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in Mphosph10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mphosph10 APN 7 64,039,503 (GRCm39) missense probably benign 0.00
IGL02113:Mphosph10 APN 7 64,026,555 (GRCm39) unclassified probably benign
IGL02615:Mphosph10 APN 7 64,030,793 (GRCm39) splice site probably benign
R0280:Mphosph10 UTSW 7 64,026,451 (GRCm39) missense possibly damaging 0.92
R0372:Mphosph10 UTSW 7 64,038,603 (GRCm39) unclassified probably benign
R0503:Mphosph10 UTSW 7 64,039,641 (GRCm39) missense probably benign
R0548:Mphosph10 UTSW 7 64,028,548 (GRCm39) missense probably benign 0.45
R1158:Mphosph10 UTSW 7 64,038,607 (GRCm39) unclassified probably benign
R1271:Mphosph10 UTSW 7 64,039,832 (GRCm39) splice site probably null
R1447:Mphosph10 UTSW 7 64,030,698 (GRCm39) missense probably damaging 1.00
R1501:Mphosph10 UTSW 7 64,039,252 (GRCm39) missense probably damaging 1.00
R1815:Mphosph10 UTSW 7 64,041,918 (GRCm39) missense probably benign 0.05
R1900:Mphosph10 UTSW 7 64,030,776 (GRCm39) missense possibly damaging 0.61
R1997:Mphosph10 UTSW 7 64,037,195 (GRCm39) critical splice donor site probably null
R2058:Mphosph10 UTSW 7 64,026,499 (GRCm39) missense probably damaging 1.00
R2059:Mphosph10 UTSW 7 64,026,499 (GRCm39) missense probably damaging 1.00
R2292:Mphosph10 UTSW 7 64,035,519 (GRCm39) missense probably damaging 1.00
R4658:Mphosph10 UTSW 7 64,038,722 (GRCm39) splice site probably null
R4817:Mphosph10 UTSW 7 64,041,969 (GRCm39) unclassified probably benign
R4968:Mphosph10 UTSW 7 64,032,656 (GRCm39) missense probably damaging 1.00
R5121:Mphosph10 UTSW 7 64,039,344 (GRCm39) missense probably damaging 1.00
R5187:Mphosph10 UTSW 7 64,035,568 (GRCm39) missense possibly damaging 0.49
R5304:Mphosph10 UTSW 7 64,038,732 (GRCm39) missense probably damaging 1.00
R5469:Mphosph10 UTSW 7 64,039,193 (GRCm39) critical splice donor site probably null
R6179:Mphosph10 UTSW 7 64,028,529 (GRCm39) missense possibly damaging 0.66
R6360:Mphosph10 UTSW 7 64,039,703 (GRCm39) missense probably benign 0.00
R6996:Mphosph10 UTSW 7 64,038,669 (GRCm39) missense probably benign 0.07
R8531:Mphosph10 UTSW 7 64,034,076 (GRCm39) missense possibly damaging 0.66
R8844:Mphosph10 UTSW 7 64,027,087 (GRCm39) missense probably damaging 0.99
R9705:Mphosph10 UTSW 7 64,027,031 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACGATCAGCACTCAAAATCTTTCTG -3'
(R):5'- GTCAAGAGCCAGTCTCCATC -3'

Sequencing Primer
(F):5'- CAGCACTCAAAATCTTTCTGAAAGG -3'
(R):5'- GTCTCCATCAAAACTAATATTCCAGG -3'
Posted On 2018-06-22