Mutagenetix > Incidental Mutation

Incidental Mutation 'R6601:Rpl7a'

525232

Institutional Source

Beutler Lab

Gene Symbol

Rpl7a

Ensembl Gene

ENSMUSG00000062647

Gene Name

ribosomal protein L7A

Synonyms

surfeit 3, Surf-3

MMRRC Submission

044725-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R6601 (G1)

Quality Score

191.009

Status

Validated

Chromosome

Chromosomal Location

26800776-26803330 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26801536 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 76 (V76A)

Ref Sequence

ENSEMBL: ENSMUSP00000099962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015017] [ENSMUST00000015920] [ENSMUST00000015934] [ENSMUST00000102898] [ENSMUST00000129682] [ENSMUST00000102899] [ENSMUST00000139815] [ENSMUST00000133513] [ENSMUST00000147110] [ENSMUST00000167661]

AlphaFold

P12970

Predicted Effect

probably benign
Transcript: ENSMUST00000015017

SMART Domains

Protein: ENSMUSP00000015017
Gene: ENSMUSG00000014873

Domain	Start	End	E-Value	Type
Pfam:SURF2	4	251	5.7e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000015920

SMART Domains

Protein: ENSMUSP00000015920
Gene: ENSMUSG00000015776

Domain	Start	End	E-Value	Type
Pfam:Med22	20	125	5.7e-40	PFAM
low complexity region	127	141	N/A	INTRINSIC
low complexity region	156	174	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000015934

SMART Domains

Protein: ENSMUSP00000015934
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	83	98	N/A	INTRINSIC
Pfam:SURF1	106	321	6.7e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083324

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083361

Predicted Effect

probably benign
Transcript: ENSMUST00000102898
AA Change: V76A

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099962
Gene: ENSMUSG00000062647
AA Change: V76A

Domain	Start	End	E-Value	Type
low complexity region	2	28	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	122	216	1.2e-25	PFAM
low complexity region	251	262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128665

Predicted Effect

probably benign
Transcript: ENSMUST00000129682

Predicted Effect

probably benign
Transcript: ENSMUST00000102899

SMART Domains

Protein: ENSMUSP00000099963
Gene: ENSMUSG00000015776

Domain	Start	End	E-Value	Type
Pfam:Med22	14	130	5.6e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139815

SMART Domains

Protein: ENSMUSP00000116442
Gene: ENSMUSG00000015776

Domain	Start	End	E-Value	Type
Pfam:Med22	14	72	3e-14	PFAM
Pfam:Med22	96	166	2.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147143

Predicted Effect

probably benign
Transcript: ENSMUST00000133513

SMART Domains

Protein: ENSMUSP00000141317
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
Pfam:SURF1	30	63	7.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143678

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136269

Predicted Effect

probably benign
Transcript: ENSMUST00000147110

SMART Domains

Protein: ENSMUSP00000141238
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
Pfam:SURF1	30	240	5.1e-56	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183520

Predicted Effect

probably benign
Transcript: ENSMUST00000167661

SMART Domains

Protein: ENSMUSP00000128488
Gene: ENSMUSG00000015790

Domain	Start	End	E-Value	Type
low complexity region	51	66	N/A	INTRINSIC
Pfam:SURF1	73	290	5.9e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150776

Meta Mutation Damage Score

0.5396

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	T	G	1: 58,102,665 (GRCm39)	L527R	probably damaging	Het
Ccdc172	T	A	19: 58,525,723 (GRCm39)	C194S	possibly damaging	Het
Ccnb1ip1	G	T	14: 51,031,121 (GRCm39)	T64K	possibly damaging	Het
Ces1b	T	C	8: 93,806,109 (GRCm39)	E44G	probably benign	Het
Coro2a	A	T	4: 46,543,421 (GRCm39)	Y317*	probably null	Het
Csnk1a1	T	C	18: 61,711,829 (GRCm39)	F281S	probably damaging	Het
Ddx28	A	T	8: 106,737,248 (GRCm39)		probably null	Het
Dtnbp1	A	G	13: 45,084,721 (GRCm39)		probably null	Het
Eif2s1	T	C	12: 78,930,126 (GRCm39)	I258T	possibly damaging	Het
Elp3	T	C	14: 65,784,488 (GRCm39)	*554W	probably null	Het
Golga1	T	C	2: 38,910,118 (GRCm39)	M610V	probably damaging	Het
Hc	T	A	2: 34,935,906 (GRCm39)	K156N	probably benign	Het
Hcls1	G	A	16: 36,782,748 (GRCm39)	G428D	probably benign	Het
Il16	T	C	7: 83,371,677 (GRCm39)	D43G	probably damaging	Het
Klhl3	C	A	13: 58,242,930 (GRCm39)	K91N	probably damaging	Het
L3mbtl1	C	T	2: 162,790,095 (GRCm39)		probably benign	Het
Lamc3	T	C	2: 31,810,544 (GRCm39)	F805L	possibly damaging	Het
Lipg	T	C	18: 75,081,275 (GRCm39)	M269V	probably benign	Het
Ly75	G	A	2: 60,148,720 (GRCm39)	T1203I	probably benign	Het
Mat1a	T	A	14: 40,827,561 (GRCm39)	V5E	probably benign	Het
Muc16	A	T	9: 18,548,866 (GRCm39)	L5809Q	probably benign	Het
Naip6	G	A	13: 100,420,266 (GRCm39)	R1335C	probably benign	Het
Ndufaf3	T	C	9: 108,443,416 (GRCm39)	H128R	probably benign	Het
Nphp4	A	T	4: 152,587,464 (GRCm39)		probably null	Het
Or8u8	T	A	2: 86,012,309 (GRCm39)	I49F	probably damaging	Het
Otop3	T	C	11: 115,230,673 (GRCm39)	V148A	probably damaging	Het
Ovgp1	T	C	3: 105,893,747 (GRCm39)		probably benign	Het
Pcsk5	T	G	19: 17,488,744 (GRCm39)	R1025S	probably benign	Het
Pkd1l2	T	C	8: 117,767,405 (GRCm39)	D1295G	probably benign	Het
Polr1d	T	A	5: 147,015,359 (GRCm39)	L14*	probably null	Het
Rab26	T	A	17: 24,748,595 (GRCm39)	K270*	probably null	Het
Rasgef1c	T	A	11: 49,862,246 (GRCm39)	N378K	probably damaging	Het
Samd9l	T	A	6: 3,377,229 (GRCm39)	I11F	possibly damaging	Het
Smarca2	C	A	19: 26,631,777 (GRCm39)	Q531K	probably benign	Het
Styxl1	C	G	5: 135,784,350 (GRCm39)	G211A	probably benign	Het
Taar9	T	C	10: 23,984,945 (GRCm39)	Y163C	probably damaging	Het
Tmem198	T	A	1: 75,457,017 (GRCm39)	F48I	possibly damaging	Het
Ttn	T	A	2: 76,595,073 (GRCm39)	N12032I	probably damaging	Het
Ubr7	T	A	12: 102,727,723 (GRCm39)	C82S	probably damaging	Het
Wwtr1	T	C	3: 57,483,159 (GRCm39)	E48G	possibly damaging	Het
Zfp108	T	C	7: 23,960,819 (GRCm39)	V470A	probably damaging	Het
Zfp612	C	A	8: 110,816,181 (GRCm39)	Q424K	possibly damaging	Het
Zscan4-ps1	T	C	7: 10,802,761 (GRCm39)	T13A	probably benign	Het

Other mutations in Rpl7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Rpl7a	APN	2	26,801,067 (GRCm39)	unclassified	probably benign
IGL00951:Rpl7a	APN	2	26,802,441 (GRCm39)	missense	possibly damaging	0.47
R0041:Rpl7a	UTSW	2	26,801,563 (GRCm39)	splice site	probably null
R1491:Rpl7a	UTSW	2	26,801,127 (GRCm39)	missense	probably damaging	0.98
R2102:Rpl7a	UTSW	2	26,801,473 (GRCm39)	missense	possibly damaging	0.93
R7378:Rpl7a	UTSW	2	26,802,019 (GRCm39)	splice site	probably null
R8926:Rpl7a	UTSW	2	26,801,557 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGATCGCTGATGCACCGAC -3'
(R):5'- TACACTGATGAGACGGCAGG -3'

Sequencing Primer
(F):5'- TGATGCACCGACGCCCTC -3'
(R):5'- AGGTCAACACGGGGATCCTTC -3'

Posted On

2018-06-22