Incidental Mutation 'R6601:Rpl7a'
ID525232
Institutional Source Beutler Lab
Gene Symbol Rpl7a
Ensembl Gene ENSMUSG00000062647
Gene Nameribosomal protein L7A
Synonymssurfeit 3, Surf-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6601 (G1)
Quality Score191.009
Status Validated
Chromosome2
Chromosomal Location26910764-26913318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26911524 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000099962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015017] [ENSMUST00000015920] [ENSMUST00000015934] [ENSMUST00000102898] [ENSMUST00000102899] [ENSMUST00000129682] [ENSMUST00000133513] [ENSMUST00000139815] [ENSMUST00000167661] [ENSMUST00000147110]
Predicted Effect probably benign
Transcript: ENSMUST00000015017
SMART Domains Protein: ENSMUSP00000015017
Gene: ENSMUSG00000014873

DomainStartEndE-ValueType
Pfam:SURF2 4 251 5.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000015920
SMART Domains Protein: ENSMUSP00000015920
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 20 125 5.7e-40 PFAM
low complexity region 127 141 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015934
SMART Domains Protein: ENSMUSP00000015934
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
Pfam:SURF1 106 321 6.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083361
Predicted Effect probably benign
Transcript: ENSMUST00000102898
AA Change: V76A

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099962
Gene: ENSMUSG00000062647
AA Change: V76A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 122 216 1.2e-25 PFAM
low complexity region 251 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102899
SMART Domains Protein: ENSMUSP00000099963
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 14 130 5.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129673
Predicted Effect probably benign
Transcript: ENSMUST00000129682
Predicted Effect probably benign
Transcript: ENSMUST00000129822
Predicted Effect probably benign
Transcript: ENSMUST00000133513
SMART Domains Protein: ENSMUSP00000141317
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 63 7.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137376
Predicted Effect probably benign
Transcript: ENSMUST00000183520
Predicted Effect probably benign
Transcript: ENSMUST00000139815
SMART Domains Protein: ENSMUSP00000116442
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 14 72 3e-14 PFAM
Pfam:Med22 96 166 2.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167661
SMART Domains Protein: ENSMUSP00000128488
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
Pfam:SURF1 73 290 5.9e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143678
Predicted Effect probably benign
Transcript: ENSMUST00000147110
SMART Domains Protein: ENSMUSP00000141238
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 240 5.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150776
Meta Mutation Damage Score 0.5396 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Rpl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Rpl7a APN 2 26911055 unclassified probably benign
IGL00951:Rpl7a APN 2 26912429 missense possibly damaging 0.47
R0041:Rpl7a UTSW 2 26911551 splice site probably null
R1491:Rpl7a UTSW 2 26911115 missense probably damaging 0.98
R2102:Rpl7a UTSW 2 26911461 missense possibly damaging 0.93
R7378:Rpl7a UTSW 2 26912007 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGATCGCTGATGCACCGAC -3'
(R):5'- TACACTGATGAGACGGCAGG -3'

Sequencing Primer
(F):5'- TGATGCACCGACGCCCTC -3'
(R):5'- AGGTCAACACGGGGATCCTTC -3'
Posted On2018-06-22