Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:Gcc2'

525233

Institutional Source

Beutler Lab

Gene Symbol

Gcc2

Ensembl Gene

ENSMUSG00000038039

Gene Name

GRIP and coiled-coil domain containing 2

Synonyms

2600014C01Rik, 0610043A03Rik, 2210420P05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.328) question?

Stock #

R6632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58255497-58305599 bp(+) (GRCm38)

Type of Mutation

splice site (714 bp from exon)

DNA Base Change (assembly)

A to G at 58270049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160416] [ENSMUST00000160427] [ENSMUST00000162041] [ENSMUST00000162860] [ENSMUST00000162984]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057659
AA Change: D369G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: D369G

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
coiled coil region	33	282	N/A	INTRINSIC
internal_repeat_2	353	378	3.94e-5	PROSPERO
internal_repeat_2	382	406	3.94e-5	PROSPERO
coiled coil region	790	882	N/A	INTRINSIC
low complexity region	939	964	N/A	INTRINSIC
internal_repeat_1	1093	1111	1.93e-5	PROSPERO
low complexity region	1115	1132	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
coiled coil region	1441	1470	N/A	INTRINSIC
internal_repeat_1	1554	1572	1.93e-5	PROSPERO
Grip	1608	1655	4.37e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160416

SMART Domains

Protein: ENSMUSP00000123873
Gene: ENSMUSG00000038039

Domain	Start	End	E-Value	Type
coiled coil region	37	176	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000160427

SMART Domains

Protein: ENSMUSP00000124411
Gene: ENSMUSG00000038039

Domain	Start	End	E-Value	Type
coiled coil region	32	94	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161570

Predicted Effect

probably damaging
Transcript: ENSMUST00000162041
AA Change: D333G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039
AA Change: D333G

Domain	Start	End	E-Value	Type
coiled coil region	32	246	N/A	INTRINSIC
internal_repeat_2	317	342	3.28e-5	PROSPERO
internal_repeat_2	346	370	3.28e-5	PROSPERO
coiled coil region	754	846	N/A	INTRINSIC
low complexity region	903	928	N/A	INTRINSIC
internal_repeat_1	1057	1075	1.6e-5	PROSPERO
low complexity region	1079	1096	N/A	INTRINSIC
low complexity region	1143	1154	N/A	INTRINSIC
coiled coil region	1405	1434	N/A	INTRINSIC
internal_repeat_1	1518	1536	1.6e-5	PROSPERO
Grip	1572	1619	4.37e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162860
AA Change: D269G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039
AA Change: D269G

Domain	Start	End	E-Value	Type
coiled coil region	46	182	N/A	INTRINSIC
internal_repeat_2	253	278	4.17e-5	PROSPERO
internal_repeat_2	282	306	4.17e-5	PROSPERO
coiled coil region	690	782	N/A	INTRINSIC
low complexity region	839	864	N/A	INTRINSIC
internal_repeat_1	993	1011	2.06e-5	PROSPERO
low complexity region	1015	1032	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
coiled coil region	1341	1370	N/A	INTRINSIC
internal_repeat_1	1450	1468	2.06e-5	PROSPERO
Grip	1504	1551	4.37e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162984

SMART Domains

Protein: ENSMUSP00000124988
Gene: ENSMUSG00000038039

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,281,067	S758P	possibly damaging	Het
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akap9	T	A	5: 4,013,842		probably null	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cep164	T	C	9: 45,779,790	K1231E	possibly damaging	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Dnaaf5	A	G	5: 139,170,333	T590A	probably benign	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Hsd17b4	A	G	18: 50,179,102	K578R	possibly damaging	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Pfkfb4	G	A	9: 109,009,562		probably null	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Setdb1	T	C	3: 95,324,149	Y1284C	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in Gcc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Gcc2	APN	10	58292680	missense	probably damaging	1.00
IGL00850:Gcc2	APN	10	58258248	missense	probably benign	0.00
IGL00935:Gcc2	APN	10	58278779	splice site	probably benign
IGL01551:Gcc2	APN	10	58298869	splice site	probably benign
IGL01642:Gcc2	APN	10	58280612	missense	probably benign	0.00
IGL02041:Gcc2	APN	10	58269281	missense	probably damaging	1.00
IGL02215:Gcc2	APN	10	58271636	missense	probably benign	0.36
IGL02448:Gcc2	APN	10	58292571	nonsense	probably null
IGL02698:Gcc2	APN	10	58271290	missense	possibly damaging	0.76
IGL02888:Gcc2	APN	10	58294828	missense	probably damaging	1.00
IGL02936:Gcc2	APN	10	58296140	missense	probably damaging	1.00
IGL03223:Gcc2	APN	10	58298734	missense	probably damaging	1.00
IGL03249:Gcc2	APN	10	58270992	nonsense	probably null
R0179:Gcc2	UTSW	10	58276650	missense	probably benign	0.39
R0528:Gcc2	UTSW	10	58298689	missense	probably damaging	1.00
R1569:Gcc2	UTSW	10	58270171	missense	probably benign	0.00
R1606:Gcc2	UTSW	10	58269448	missense	probably damaging	1.00
R1725:Gcc2	UTSW	10	58304115	missense	possibly damaging	0.95
R1916:Gcc2	UTSW	10	58276663	missense	probably damaging	1.00
R1956:Gcc2	UTSW	10	58286143	missense	possibly damaging	0.66
R2058:Gcc2	UTSW	10	58285957	missense	probably benign	0.10
R2114:Gcc2	UTSW	10	58269540	nonsense	probably null
R2280:Gcc2	UTSW	10	58269680	missense	probably benign	0.38
R2435:Gcc2	UTSW	10	58294780	missense	probably damaging	1.00
R2876:Gcc2	UTSW	10	58290302	missense	probably damaging	0.99
R4753:Gcc2	UTSW	10	58290382	missense	probably benign	0.20
R4827:Gcc2	UTSW	10	58286131	critical splice acceptor site	probably null
R4911:Gcc2	UTSW	10	58270439	missense	probably damaging	1.00
R5033:Gcc2	UTSW	10	58278806	missense	probably damaging	0.98
R5224:Gcc2	UTSW	10	58286160	missense	probably damaging	1.00
R5271:Gcc2	UTSW	10	58269695	missense	possibly damaging	0.46
R5398:Gcc2	UTSW	10	58269507	missense	probably benign	0.00
R5411:Gcc2	UTSW	10	58270969	missense	probably damaging	0.99
R5594:Gcc2	UTSW	10	58287242	missense	probably damaging	0.99
R5825:Gcc2	UTSW	10	58294821	missense	probably damaging	1.00
R5974:Gcc2	UTSW	10	58258243	missense	probably damaging	0.99
R5987:Gcc2	UTSW	10	58255847	utr 5 prime	probably benign
R6195:Gcc2	UTSW	10	58270984	missense	probably damaging	0.96
R6198:Gcc2	UTSW	10	58292590	missense	probably benign	0.26
R6233:Gcc2	UTSW	10	58270984	missense	probably damaging	0.96
R6331:Gcc2	UTSW	10	58271465	missense	probably benign
R6349:Gcc2	UTSW	10	58269474	missense	probably benign	0.01
R6593:Gcc2	UTSW	10	58271507	missense	probably damaging	1.00
R6647:Gcc2	UTSW	10	58287281	critical splice donor site	probably null
R6774:Gcc2	UTSW	10	58281439	missense	possibly damaging	0.94
R6808:Gcc2	UTSW	10	58258242	missense	probably damaging	0.99
R7072:Gcc2	UTSW	10	58270927	missense	probably benign	0.02
R7220:Gcc2	UTSW	10	58280594	missense	probably benign	0.00
R7352:Gcc2	UTSW	10	58280698	critical splice donor site	probably null
R7384:Gcc2	UTSW	10	58269964	missense	probably damaging	1.00
R7439:Gcc2	UTSW	10	58256901	missense	probably benign	0.08
R7441:Gcc2	UTSW	10	58256901	missense	probably benign	0.08
R7543:Gcc2	UTSW	10	58271264	missense	probably benign	0.02
R7843:Gcc2	UTSW	10	58268021	missense	possibly damaging	0.77
R7850:Gcc2	UTSW	10	58278881	missense	probably damaging	0.96
R7980:Gcc2	UTSW	10	58278752	splice site	probably null
R8336:Gcc2	UTSW	10	58272367	missense	probably damaging	0.99
R8785:Gcc2	UTSW	10	58271264	missense	probably benign	0.02
R8834:Gcc2	UTSW	10	58286045	critical splice donor site	probably null
R9006:Gcc2	UTSW	10	58267979	missense	probably damaging	1.00
R9036:Gcc2	UTSW	10	58270589	missense	possibly damaging	0.63
R9240:Gcc2	UTSW	10	58270576	nonsense	probably null
R9287:Gcc2	UTSW	10	58269395	nonsense	probably null
R9370:Gcc2	UTSW	10	58296118	missense	probably benign	0.00
R9433:Gcc2	UTSW	10	58270770	missense	probably benign	0.06
R9653:Gcc2	UTSW	10	58275000	missense	possibly damaging	0.87
X0018:Gcc2	UTSW	10	58278814	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAAATGAAGTCGCCTCAGATGC -3'
(R):5'- TTCTGATGGTGTTCCTGAAGAC -3'

Sequencing Primer
(F):5'- CAGAATTGCTCTGTGGCCTTACAG -3'
(R):5'- GTTCCTGAAGACGCTGTATTTC -3'

Posted On

2018-06-22