Incidental Mutation 'R6632:Nrxn3'
ID 525242
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Name neurexin III
Synonyms 4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 88722876-90334935 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89193154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 17 (A17T)
Ref Sequence ENSEMBL: ENSMUSP00000127926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
AlphaFold Q6P9K9
Predicted Effect probably damaging
Transcript: ENSMUST00000057634
AA Change: A17T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392
AA Change: A17T

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163134
AA Change: A390T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: A390T

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167103
AA Change: A390T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: A390T

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167734
Predicted Effect probably damaging
Transcript: ENSMUST00000167887
AA Change: A17T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392
AA Change: A17T

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190626
AA Change: A17T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392
AA Change: A17T

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,281,067 S758P possibly damaging Het
Abca3 C G 17: 24,384,470 D545E probably benign Het
Akap9 T A 5: 4,013,842 probably null Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arpp21 G A 9: 112,127,356 Q518* probably null Het
Atp9b G A 18: 80,808,649 R410W probably damaging Het
Cacna2d3 T C 14: 28,905,265 *265W probably null Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cep164 T C 9: 45,779,790 K1231E possibly damaging Het
Cnot1 A G 8: 95,773,267 probably benign Het
Cpne2 T C 8: 94,554,955 V206A probably benign Het
Dchs1 A G 7: 105,761,878 Y1647H probably damaging Het
Dnaaf5 A G 5: 139,170,333 T590A probably benign Het
Eif4g1 A T 16: 20,685,520 I1068F probably damaging Het
Ephb4 A T 5: 137,366,587 K639N probably damaging Het
Gcc2 A G 10: 58,270,049 probably null Het
Gm35315 A C 5: 110,079,263 Y103* probably null Het
Hsd17b4 A G 18: 50,179,102 K578R possibly damaging Het
Ice2 T C 9: 69,428,452 S906P probably benign Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1b A T 2: 40,725,442 W3650R probably benign Het
Mcoln3 C T 3: 146,128,187 H161Y probably benign Het
Mphosph10 A T 7: 64,385,819 M368K probably damaging Het
Msh2 A C 17: 87,712,666 K567Q possibly damaging Het
N4bp3 T C 11: 51,643,949 E429G possibly damaging Het
Olfr1459 T A 19: 13,146,188 Y157F probably benign Het
Olfr171 T C 16: 19,625,023 T26A probably benign Het
P4ha2 G T 11: 54,117,648 R227L probably benign Het
Pfkfb4 G A 9: 109,009,562 probably null Het
Ror1 A G 4: 100,442,106 N892S probably benign Het
Scn9a G T 2: 66,483,502 D1957E probably benign Het
Sec24a A T 11: 51,713,649 Y713* probably null Het
Serpinb1b T A 13: 33,087,455 F70I probably damaging Het
Setdb1 T C 3: 95,324,149 Y1284C probably damaging Het
Suco A T 1: 161,828,240 M1030K possibly damaging Het
Syne1 A T 10: 5,215,667 probably null Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89813642 critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89976392 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90331956 missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88795582 missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89255034 missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89510607 missense probably damaging 1.00
R7328:Nrxn3 UTSW 12 88795575 missense probably benign
R7352:Nrxn3 UTSW 12 88850293 missense probably benign
R7425:Nrxn3 UTSW 12 89513100 nonsense probably null
R7444:Nrxn3 UTSW 12 89510694 missense probably damaging 1.00
R7483:Nrxn3 UTSW 12 89510462 missense probably damaging 1.00
R7599:Nrxn3 UTSW 12 89512062 missense probably benign
R7738:Nrxn3 UTSW 12 88850304 missense possibly damaging 0.68
R7765:Nrxn3 UTSW 12 89813484 missense probably benign 0.03
R8139:Nrxn3 UTSW 12 90204664 missense probably benign 0.01
R8192:Nrxn3 UTSW 12 90204795 missense probably benign 0.08
R8351:Nrxn3 UTSW 12 89510643 missense probably damaging 1.00
R8368:Nrxn3 UTSW 12 90332041 nonsense probably null
R8397:Nrxn3 UTSW 12 90331809 missense probably benign 0.17
R8426:Nrxn3 UTSW 12 88795327 missense possibly damaging 0.91
R8451:Nrxn3 UTSW 12 89510643 missense probably damaging 1.00
R8777:Nrxn3 UTSW 12 89260464 missense probably damaging 1.00
R8777-TAIL:Nrxn3 UTSW 12 89260464 missense probably damaging 1.00
R8844:Nrxn3 UTSW 12 89187150 missense possibly damaging 0.88
R8870:Nrxn3 UTSW 12 90204786 missense probably benign 0.00
R9043:Nrxn3 UTSW 12 89260482 missense probably damaging 1.00
R9102:Nrxn3 UTSW 12 90332150 missense probably benign 0.01
R9167:Nrxn3 UTSW 12 89187298 missense probably damaging 1.00
R9445:Nrxn3 UTSW 12 89532967 nonsense probably null
R9447:Nrxn3 UTSW 12 89254908 missense probably benign 0.35
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Z1176:Nrxn3 UTSW 12 89187055 nonsense probably null
Z1176:Nrxn3 UTSW 12 89517909 missense possibly damaging 0.45
Z1177:Nrxn3 UTSW 12 88795688 missense probably benign 0.00
Z1177:Nrxn3 UTSW 12 89260312 missense probably damaging 1.00
Z1177:Nrxn3 UTSW 12 90331845 missense probably benign 0.05
Z1177:Nrxn3 UTSW 12 90332114 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGCTGAAACCACAACTAGG -3'
(R):5'- GGTAATTAAGTAGCAAACCTAAGGCC -3'

Sequencing Primer
(F):5'- CTAGGGGAAGCCAATGAGTTTTAAC -3'
(R):5'- ATGCACAGCCATTGGTCTAG -3'
Posted On 2018-06-22