Incidental Mutation 'R6601:Olfr52'
ID525244
Institutional Source Beutler Lab
Gene Symbol Olfr52
Ensembl Gene ENSMUSG00000075199
Gene Nameolfactory receptor 52
SynonymsIE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86179412-86185683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86181965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 49 (I49F)
Ref Sequence ENSEMBL: ENSMUSP00000097489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099905] [ENSMUST00000215138] [ENSMUST00000215171]
Predicted Effect probably damaging
Transcript: ENSMUST00000099905
AA Change: I49F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097489
Gene: ENSMUSG00000075199
AA Change: I49F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5e-56 PFAM
Pfam:7tm_1 41 290 3.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215138
AA Change: I49F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215739
Meta Mutation Damage Score 0.5099 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Olfr52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Olfr52 APN 2 86181595 splice site probably null
R0422:Olfr52 UTSW 2 86181222 missense probably benign 0.00
R0688:Olfr52 UTSW 2 86181605 splice site probably null
R0976:Olfr52 UTSW 2 86181808 missense probably damaging 0.99
R1240:Olfr52 UTSW 2 86182109 start codon destroyed possibly damaging 0.94
R1316:Olfr52 UTSW 2 86181365 missense probably benign 0.01
R1865:Olfr52 UTSW 2 86181538 missense probably damaging 1.00
R2188:Olfr52 UTSW 2 86181436 missense probably damaging 1.00
R4072:Olfr52 UTSW 2 86181647 missense probably benign 0.02
R4222:Olfr52 UTSW 2 86181997 missense probably damaging 0.99
R5096:Olfr52 UTSW 2 86181932 missense probably damaging 1.00
R5103:Olfr52 UTSW 2 86181616 missense probably benign 0.41
R5934:Olfr52 UTSW 2 86182102 missense probably benign 0.00
R6168:Olfr52 UTSW 2 86181965 missense probably damaging 0.99
R7448:Olfr52 UTSW 2 86181334 missense probably damaging 1.00
R7497:Olfr52 UTSW 2 86182073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGGTTACAAATTGCTGCATATC -3'
(R):5'- TACTCCTCCTACAGATGTCCTGAAG -3'

Sequencing Primer
(F):5'- TCTATCATATGCCATGGAAGCCAGG -3'
(R):5'- ATGTCCTGAAGACTCATGGC -3'
Posted On2018-06-22