Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:2210408I21Rik'

525248

Institutional Source

Beutler Lab

Gene Symbol

2210408I21Rik

Ensembl Gene

ENSMUSG00000071252

Gene Name

RIKEN cDNA 2210408I21 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77135540-77613784 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77281067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 758 (S758P)

Ref Sequence

ENSEMBL: ENSMUSP00000127449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168779]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168779
AA Change: S758P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: S758P

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	151	164	N/A	INTRINSIC
Pfam:DUF4495	515	832	1.6e-140	PFAM
low complexity region	1241	1255	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akap9	T	A	5: 4,013,842		probably null	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cep164	T	C	9: 45,779,790	K1231E	possibly damaging	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Dnaaf5	A	G	5: 139,170,333	T590A	probably benign	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gcc2	A	G	10: 58,270,049		probably null	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Hsd17b4	A	G	18: 50,179,102	K578R	possibly damaging	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Pfkfb4	G	A	9: 109,009,562		probably null	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Setdb1	T	C	3: 95,324,149	Y1284C	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in 2210408I21Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:2210408I21Rik	APN	13	77323358	splice site	probably benign
IGL01154:2210408I21Rik	APN	13	77281094	missense	probably benign	0.01
IGL01461:2210408I21Rik	APN	13	77281095	missense	probably benign	0.25
IGL01624:2210408I21Rik	APN	13	77193086	missense	probably damaging	0.99
IGL02033:2210408I21Rik	APN	13	77259876	missense	possibly damaging	0.90
IGL02621:2210408I21Rik	APN	13	77260031	missense	possibly damaging	0.92
IGL02718:2210408I21Rik	APN	13	77174872	missense	probably damaging	1.00
IGL02823:2210408I21Rik	APN	13	77261955	missense	probably damaging	0.96
IGL02859:2210408I21Rik	APN	13	77267699	missense	possibly damaging	0.71
IGL03006:2210408I21Rik	APN	13	77323772	critical splice donor site	probably null
IGL03072:2210408I21Rik	APN	13	77259997	missense	probably benign
IGL03184:2210408I21Rik	APN	13	77323451	missense	possibly damaging	0.63
IGL03275:2210408I21Rik	APN	13	77298555	missense	possibly damaging	0.71
PIT4651001:2210408I21Rik	UTSW	13	77259895	missense	probably benign
R0226:2210408I21Rik	UTSW	13	77303425	missense	possibly damaging	0.86
R0323:2210408I21Rik	UTSW	13	77298555	missense	possibly damaging	0.71
R0614:2210408I21Rik	UTSW	13	77192663	missense	probably benign	0.26
R0894:2210408I21Rik	UTSW	13	77323607	missense	probably benign	0.18
R1165:2210408I21Rik	UTSW	13	77334287	missense	probably benign	0.06
R1509:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R1711:2210408I21Rik	UTSW	13	77269920	missense	possibly damaging	0.93
R1714:2210408I21Rik	UTSW	13	77316360	missense	possibly damaging	0.86
R1718:2210408I21Rik	UTSW	13	77245370	intron	probably benign
R1836:2210408I21Rik	UTSW	13	77323374	missense	probably benign	0.00
R1893:2210408I21Rik	UTSW	13	77267809	missense	possibly damaging	0.93
R2035:2210408I21Rik	UTSW	13	77612642	makesense	probably null
R2329:2210408I21Rik	UTSW	13	77303325	missense	probably benign	0.04
R2897:2210408I21Rik	UTSW	13	77323521	missense	probably benign	0.33
R3688:2210408I21Rik	UTSW	13	77267849	missense	possibly damaging	0.52
R4153:2210408I21Rik	UTSW	13	77193173	missense	probably benign	0.00
R4387:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4388:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4499:2210408I21Rik	UTSW	13	77316527	missense	possibly damaging	0.96
R4614:2210408I21Rik	UTSW	13	77254256	splice site	probably null
R4798:2210408I21Rik	UTSW	13	77323724	missense	possibly damaging	0.96
R4943:2210408I21Rik	UTSW	13	77245327	missense	possibly damaging	0.86
R5045:2210408I21Rik	UTSW	13	77267808	splice site	probably null
R5387:2210408I21Rik	UTSW	13	77259973	missense	probably benign	0.11
R5500:2210408I21Rik	UTSW	13	77303389	missense	probably benign	0.33
R5686:2210408I21Rik	UTSW	13	77303314	missense	possibly damaging	0.72
R6111:2210408I21Rik	UTSW	13	77327902	missense	possibly damaging	0.72
R6135:2210408I21Rik	UTSW	13	77254216	missense	probably damaging	0.98
R6188:2210408I21Rik	UTSW	13	77183731	missense	possibly damaging	0.53
R6388:2210408I21Rik	UTSW	13	77262111	missense	probably benign
R6588:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R6638:2210408I21Rik	UTSW	13	77303402	missense	probably benign	0.07
R6755:2210408I21Rik	UTSW	13	77327875	missense	probably benign
R6971:2210408I21Rik	UTSW	13	77193187	missense	possibly damaging	0.90
R7079:2210408I21Rik	UTSW	13	77254204	missense	possibly damaging	0.86
R7130:2210408I21Rik	UTSW	13	77269902	missense	possibly damaging	0.93
R7215:2210408I21Rik	UTSW	13	77323571	missense	possibly damaging	0.96
R7272:2210408I21Rik	UTSW	13	77323536	missense	probably benign	0.00
R7331:2210408I21Rik	UTSW	13	77183609	missense	possibly damaging	0.53
R7561:2210408I21Rik	UTSW	13	77193195	missense	probably benign
R7684:2210408I21Rik	UTSW	13	77612540	nonsense	probably null
R7728:2210408I21Rik	UTSW	13	77316477	missense	possibly damaging	0.96
R7881:2210408I21Rik	UTSW	13	77323566	missense	possibly damaging	0.53
R7963:2210408I21Rik	UTSW	13	77192554	missense	probably benign	0.02
R8008:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8024:2210408I21Rik	UTSW	13	77612594	missense	probably benign
R8170:2210408I21Rik	UTSW	13	77263594	missense	probably benign	0.06
R8201:2210408I21Rik	UTSW	13	77193159	missense	possibly damaging	0.72
R8255:2210408I21Rik	UTSW	13	77267731	missense	possibly damaging	0.71
R8296:2210408I21Rik	UTSW	13	77267777	missense	probably damaging	0.98
R8476:2210408I21Rik	UTSW	13	77261901	missense	possibly damaging	0.92
R8526:2210408I21Rik	UTSW	13	77269816	nonsense	probably null
R8746:2210408I21Rik	UTSW	13	77303410	missense	probably benign	0.01
R8812:2210408I21Rik	UTSW	13	77332352	missense	probably damaging	0.98
R8870:2210408I21Rik	UTSW	13	77323721	missense	possibly damaging	0.96
R8885:2210408I21Rik	UTSW	13	77323406	missense	possibly damaging	0.91
R8910:2210408I21Rik	UTSW	13	77323649	missense	probably benign	0.03
R8911:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8965:2210408I21Rik	UTSW	13	77612604	missense	probably benign	0.02
R8968:2210408I21Rik	UTSW	13	77332310	nonsense	probably null
R8989:2210408I21Rik	UTSW	13	77612605	missense	probably benign	0.01
R9163:2210408I21Rik	UTSW	13	77245281	missense	possibly damaging	0.73
R9378:2210408I21Rik	UTSW	13	77323616	missense	possibly damaging	0.53
R9478:2210408I21Rik	UTSW	13	77303454	missense	possibly damaging	0.53
R9523:2210408I21Rik	UTSW	13	77259869	missense	possibly damaging	0.53
R9595:2210408I21Rik	UTSW	13	77316447	missense	probably benign
X0066:2210408I21Rik	UTSW	13	77183640	missense	possibly damaging	0.72
Z1088:2210408I21Rik	UTSW	13	77174891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTTCCTCTATGTAAGGATTGTTC -3'
(R):5'- AAATTCCTTTTGTAAGACCCCAGC -3'

Sequencing Primer
(F):5'- CTAATTCTTGATTCTTGGTTTGTGTG -3'
(R):5'- TTTTGTAAGACCCCAGCAAACC -3'

Posted On

2018-06-22