Incidental Mutation 'R6632:2210408I21Rik'
ID 525248
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene Name RIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 77283659-77761903 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77429186 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 758 (S758P)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: S758P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: S758P

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cnot1 A G 8: 96,499,895 (GRCm39) probably benign Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Dnaaf5 A G 5: 139,156,088 (GRCm39) T590A probably benign Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Gm35315 A C 5: 110,227,129 (GRCm39) Y103* probably null Het
Hsd17b4 A G 18: 50,312,169 (GRCm39) K578R possibly damaging Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Mphosph10 A T 7: 64,035,567 (GRCm39) M368K probably damaging Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Suco A T 1: 161,655,809 (GRCm39) M1030K possibly damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77,471,477 (GRCm39) splice site probably benign
IGL01154:2210408I21Rik APN 13 77,429,213 (GRCm39) missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77,429,214 (GRCm39) missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77,341,205 (GRCm39) missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77,407,995 (GRCm39) missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77,408,150 (GRCm39) missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77,322,991 (GRCm39) missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77,410,074 (GRCm39) missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77,415,818 (GRCm39) missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77,471,891 (GRCm39) critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77,408,116 (GRCm39) missense probably benign
IGL03184:2210408I21Rik APN 13 77,471,570 (GRCm39) missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77,446,674 (GRCm39) missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77,408,014 (GRCm39) missense probably benign
R0226:2210408I21Rik UTSW 13 77,451,544 (GRCm39) missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77,446,674 (GRCm39) missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77,340,782 (GRCm39) missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77,471,726 (GRCm39) missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77,482,406 (GRCm39) missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77,340,766 (GRCm39) missense probably benign
R1711:2210408I21Rik UTSW 13 77,418,039 (GRCm39) missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77,464,479 (GRCm39) missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77,393,489 (GRCm39) intron probably benign
R1836:2210408I21Rik UTSW 13 77,471,493 (GRCm39) missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77,415,928 (GRCm39) missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77,760,761 (GRCm39) makesense probably null
R2329:2210408I21Rik UTSW 13 77,451,444 (GRCm39) missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77,471,640 (GRCm39) missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77,415,968 (GRCm39) missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77,341,292 (GRCm39) missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77,464,693 (GRCm39) critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77,464,693 (GRCm39) critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77,464,646 (GRCm39) missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77,402,375 (GRCm39) splice site probably null
R4798:2210408I21Rik UTSW 13 77,471,843 (GRCm39) missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77,393,446 (GRCm39) missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77,415,927 (GRCm39) splice site probably null
R5387:2210408I21Rik UTSW 13 77,408,092 (GRCm39) missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77,451,508 (GRCm39) missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77,451,433 (GRCm39) missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77,476,021 (GRCm39) missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77,402,335 (GRCm39) missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77,331,850 (GRCm39) missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77,410,230 (GRCm39) missense probably benign
R6588:2210408I21Rik UTSW 13 77,340,766 (GRCm39) missense probably benign
R6638:2210408I21Rik UTSW 13 77,451,521 (GRCm39) missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77,475,994 (GRCm39) missense probably benign
R6971:2210408I21Rik UTSW 13 77,341,306 (GRCm39) missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77,402,323 (GRCm39) missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77,418,021 (GRCm39) missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77,471,690 (GRCm39) missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77,471,655 (GRCm39) missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77,331,728 (GRCm39) missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77,341,314 (GRCm39) missense probably benign
R7684:2210408I21Rik UTSW 13 77,760,659 (GRCm39) nonsense probably null
R7728:2210408I21Rik UTSW 13 77,464,596 (GRCm39) missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77,471,685 (GRCm39) missense possibly damaging 0.53
R7963:2210408I21Rik UTSW 13 77,340,673 (GRCm39) missense probably benign 0.02
R8008:2210408I21Rik UTSW 13 77,429,234 (GRCm39) missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77,760,713 (GRCm39) missense probably benign
R8170:2210408I21Rik UTSW 13 77,411,713 (GRCm39) missense probably benign 0.06
R8201:2210408I21Rik UTSW 13 77,341,278 (GRCm39) missense possibly damaging 0.72
R8255:2210408I21Rik UTSW 13 77,415,850 (GRCm39) missense possibly damaging 0.71
R8296:2210408I21Rik UTSW 13 77,415,896 (GRCm39) missense probably damaging 0.98
R8476:2210408I21Rik UTSW 13 77,410,020 (GRCm39) missense possibly damaging 0.92
R8526:2210408I21Rik UTSW 13 77,417,935 (GRCm39) nonsense probably null
R8746:2210408I21Rik UTSW 13 77,451,529 (GRCm39) missense probably benign 0.01
R8812:2210408I21Rik UTSW 13 77,480,471 (GRCm39) missense probably damaging 0.98
R8870:2210408I21Rik UTSW 13 77,471,840 (GRCm39) missense possibly damaging 0.96
R8885:2210408I21Rik UTSW 13 77,471,525 (GRCm39) missense possibly damaging 0.91
R8910:2210408I21Rik UTSW 13 77,471,768 (GRCm39) missense probably benign 0.03
R8911:2210408I21Rik UTSW 13 77,429,234 (GRCm39) missense probably benign 0.28
R8965:2210408I21Rik UTSW 13 77,760,723 (GRCm39) missense probably benign 0.02
R8968:2210408I21Rik UTSW 13 77,480,429 (GRCm39) nonsense probably null
R8989:2210408I21Rik UTSW 13 77,760,724 (GRCm39) missense probably benign 0.01
R9163:2210408I21Rik UTSW 13 77,393,400 (GRCm39) missense possibly damaging 0.73
R9378:2210408I21Rik UTSW 13 77,471,735 (GRCm39) missense possibly damaging 0.53
R9478:2210408I21Rik UTSW 13 77,451,573 (GRCm39) missense possibly damaging 0.53
R9523:2210408I21Rik UTSW 13 77,407,988 (GRCm39) missense possibly damaging 0.53
R9595:2210408I21Rik UTSW 13 77,464,566 (GRCm39) missense probably benign
X0066:2210408I21Rik UTSW 13 77,331,759 (GRCm39) missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77,323,010 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTCCTCTATGTAAGGATTGTTC -3'
(R):5'- AAATTCCTTTTGTAAGACCCCAGC -3'

Sequencing Primer
(F):5'- CTAATTCTTGATTCTTGGTTTGTGTG -3'
(R):5'- TTTTGTAAGACCCCAGCAAACC -3'
Posted On 2018-06-22