Incidental Mutation 'R6601:Coro2a'
ID525251
Institutional Source Beutler Lab
Gene Symbol Coro2a
Ensembl Gene ENSMUSG00000028337
Gene Namecoronin, actin binding protein 2A
Synonymscoronin 4, IR10, 9030208C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location46536937-46602202 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 46543421 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 317 (Y317*)
Ref Sequence ENSEMBL: ENSMUSP00000103386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030021] [ENSMUST00000107756] [ENSMUST00000107757]
Predicted Effect probably null
Transcript: ENSMUST00000030021
AA Change: Y298*
SMART Domains Protein: ENSMUSP00000030021
Gene: ENSMUSG00000028337
AA Change: Y298*

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107756
AA Change: Y298*
SMART Domains Protein: ENSMUSP00000103385
Gene: ENSMUSG00000028337
AA Change: Y298*

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107757
AA Change: Y317*
SMART Domains Protein: ENSMUSP00000103386
Gene: ENSMUSG00000028337
AA Change: Y317*

DomainStartEndE-ValueType
DUF1899 24 88 3.93e-33 SMART
WD40 87 130 2.04e-5 SMART
WD40 140 180 1.58e-2 SMART
WD40 188 227 2.55e-6 SMART
DUF1900 280 416 9.15e-84 SMART
coiled coil region 507 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139179
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 5 WD repeats, and has a structural similarity with actin-binding proteins: the D. discoideum coronin and the human p57 protein, suggesting that this protein may also be an actin-binding protein that regulates cell motility. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Coro2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Coro2a APN 4 46540455 missense probably benign 0.06
IGL03093:Coro2a APN 4 46544158 missense possibly damaging 0.93
lonewolf UTSW 4 46542255 missense probably damaging 1.00
R1562:Coro2a UTSW 4 46548917 missense probably benign 0.02
R1862:Coro2a UTSW 4 46548797 missense possibly damaging 0.93
R1931:Coro2a UTSW 4 46539138 makesense probably null
R4385:Coro2a UTSW 4 46541961 missense possibly damaging 0.93
R5171:Coro2a UTSW 4 46542372 intron probably benign
R5243:Coro2a UTSW 4 46545620 missense probably damaging 1.00
R5393:Coro2a UTSW 4 46542255 missense probably damaging 1.00
R5785:Coro2a UTSW 4 46564691 missense probably benign 0.03
R6014:Coro2a UTSW 4 46542261 missense probably damaging 1.00
R6184:Coro2a UTSW 4 46540504 missense probably benign
R6264:Coro2a UTSW 4 46562912 missense probably damaging 1.00
R6732:Coro2a UTSW 4 46551374 missense probably damaging 0.99
R6760:Coro2a UTSW 4 46540572 missense probably benign
R7499:Coro2a UTSW 4 46539188 missense probably benign 0.01
R7516:Coro2a UTSW 4 46562992 missense probably benign 0.12
R7567:Coro2a UTSW 4 46546674 missense probably damaging 0.99
R7816:Coro2a UTSW 4 46546809 missense probably benign 0.01
R8008:Coro2a UTSW 4 46551349 missense probably damaging 1.00
R8236:Coro2a UTSW 4 46548796 missense possibly damaging 0.93
R8513:Coro2a UTSW 4 46544117 frame shift probably null
R8515:Coro2a UTSW 4 46544117 frame shift probably null
RF012:Coro2a UTSW 4 46542336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTTCAGCACTGATACTG -3'
(R):5'- GACTTAGCCTTGGCAACTGG -3'

Sequencing Primer
(F):5'- GCTTCAGCACTGATACTGTCATCAAG -3'
(R):5'- GCCAGGCCAAAGCTTTCC -3'
Posted On2018-06-22