Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:Hsd17b4'

525260

Institutional Source

Beutler Lab

Gene Symbol

Hsd17b4

Ensembl Gene

ENSMUSG00000024507

Gene Name

hydroxysteroid (17-beta) dehydrogenase 4

Synonyms

D-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2

MMRRC Submission

044754-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.669) question?

Stock #

R6632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50128201-50196269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50179102 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 578 (K578R)

Ref Sequence

ENSEMBL: ENSMUSP00000025385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025385]

AlphaFold

P51660

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025385
AA Change: K578R

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: K578R

Domain	Start	End	E-Value	Type
Pfam:KR	10	186	2.1e-17	PFAM
Pfam:adh_short	10	208	2.3e-39	PFAM
Pfam:MaoC_dehydrat_N	346	451	1.4e-8	PFAM
low complexity region	458	470	N/A	INTRINSIC
Pfam:MaoC_dehydratas	479	600	1.8e-41	PFAM
Pfam:SCP2	627	730	8.4e-27	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,281,067	S758P	possibly damaging	Het
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akap9	T	A	5: 4,013,842		probably null	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cep164	T	C	9: 45,779,790	K1231E	possibly damaging	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Dnaaf5	A	G	5: 139,170,333	T590A	probably benign	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gcc2	A	G	10: 58,270,049		probably null	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Pfkfb4	G	A	9: 109,009,562		probably null	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Setdb1	T	C	3: 95,324,149	Y1284C	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in Hsd17b4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00646:Hsd17b4	APN	18	50164845	missense	probably benign
IGL01369:Hsd17b4	APN	18	50172033	missense	possibly damaging	0.95
IGL01411:Hsd17b4	APN	18	50191814	missense	probably damaging	1.00
IGL01986:Hsd17b4	APN	18	50160126	splice site	probably benign
IGL02126:Hsd17b4	APN	18	50181996	missense	probably benign
IGL02496:Hsd17b4	APN	18	50155153	missense	probably damaging	0.97
IGL02527:Hsd17b4	APN	18	50160164	missense	probably benign	0.00
IGL02553:Hsd17b4	APN	18	50162097	splice site	probably benign
IGL02813:Hsd17b4	APN	18	50128348	utr 5 prime	probably benign
inauspicious	UTSW	18	50146424	missense	probably damaging	1.00
I0000:Hsd17b4	UTSW	18	50160228	missense	probably benign	0.09
IGL02980:Hsd17b4	UTSW	18	50146518	missense	probably benign	0.06
R0352:Hsd17b4	UTSW	18	50191784	missense	probably benign
R0734:Hsd17b4	UTSW	18	50170777	missense	possibly damaging	0.90
R0967:Hsd17b4	UTSW	18	50183261	missense	probably benign	0.00
R1418:Hsd17b4	UTSW	18	50130187	splice site	probably benign
R1661:Hsd17b4	UTSW	18	50160215	missense	probably benign
R1665:Hsd17b4	UTSW	18	50160215	missense	probably benign
R1752:Hsd17b4	UTSW	18	50170767	missense	probably benign	0.27
R1804:Hsd17b4	UTSW	18	50177984	missense	probably damaging	1.00
R2197:Hsd17b4	UTSW	18	50183302	splice site	probably null
R4351:Hsd17b4	UTSW	18	50142634	missense	probably damaging	1.00
R4405:Hsd17b4	UTSW	18	50128314	start gained	probably benign
R4976:Hsd17b4	UTSW	18	50160135	missense	probably damaging	1.00
R5788:Hsd17b4	UTSW	18	50173709	missense	probably damaging	0.99
R5826:Hsd17b4	UTSW	18	50183172	missense	probably benign	0.00
R5889:Hsd17b4	UTSW	18	50177209	missense	probably damaging	1.00
R6475:Hsd17b4	UTSW	18	50172262	splice site	probably null
R7151:Hsd17b4	UTSW	18	50128370	missense	probably damaging	1.00
R7367:Hsd17b4	UTSW	18	50155185	missense	probably damaging	1.00
R7383:Hsd17b4	UTSW	18	50164850	missense	probably benign	0.13
R7397:Hsd17b4	UTSW	18	50146424	missense	probably damaging	1.00
R7509:Hsd17b4	UTSW	18	50164682	missense	probably damaging	1.00
R7697:Hsd17b4	UTSW	18	50130141	missense	probably damaging	1.00
R7722:Hsd17b4	UTSW	18	50146524	missense	probably damaging	1.00
R7764:Hsd17b4	UTSW	18	50146415	nonsense	probably null
R8065:Hsd17b4	UTSW	18	50170752	missense	possibly damaging	0.90
R8264:Hsd17b4	UTSW	18	50146526	missense	possibly damaging	0.79
R8350:Hsd17b4	UTSW	18	50164667	missense	probably benign	0.00
R8450:Hsd17b4	UTSW	18	50164667	missense	probably benign	0.00
R9345:Hsd17b4	UTSW	18	50166914	missense	probably benign	0.04
R9654:Hsd17b4	UTSW	18	50139466	missense	probably benign	0.01
R9705:Hsd17b4	UTSW	18	50191724	missense	probably benign	0.41
R9790:Hsd17b4	UTSW	18	50191840	critical splice donor site	probably null
R9791:Hsd17b4	UTSW	18	50191840	critical splice donor site	probably null
Z1177:Hsd17b4	UTSW	18	50181980	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGGTTTGTCTCGAGCAAAAGC -3'
(R):5'- TCCCAAGCGTCTCTCAAAGAG -3'

Sequencing Primer
(F):5'- GTCTCGAGCAAAAGCTTCTTG -3'
(R):5'- AGCGTCTCTCAAAGAGTCCTATTAC -3'

Posted On

2018-06-22