Incidental Mutation 'R6632:Hsd17b4'
ID 525260
Institutional Source Beutler Lab
Gene Symbol Hsd17b4
Ensembl Gene ENSMUSG00000024507
Gene Name hydroxysteroid (17-beta) dehydrogenase 4
Synonyms 17[b]-HSD, Mfp-2, multifunctional protein 2, D-bifunctional protein, perMFE-2, MFP2, MFE-2
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.580) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 50261268-50329336 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50312169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 578 (K578R)
Ref Sequence ENSEMBL: ENSMUSP00000025385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025385]
AlphaFold P51660
Predicted Effect possibly damaging
Transcript: ENSMUST00000025385
AA Change: K578R

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: K578R

DomainStartEndE-ValueType
Pfam:KR 10 186 2.1e-17 PFAM
Pfam:adh_short 10 208 2.3e-39 PFAM
Pfam:MaoC_dehydrat_N 346 451 1.4e-8 PFAM
low complexity region 458 470 N/A INTRINSIC
Pfam:MaoC_dehydratas 479 600 1.8e-41 PFAM
Pfam:SCP2 627 730 8.4e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,429,186 (GRCm39) S758P possibly damaging Het
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cnot1 A G 8: 96,499,895 (GRCm39) probably benign Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Dnaaf5 A G 5: 139,156,088 (GRCm39) T590A probably benign Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Gm35315 A C 5: 110,227,129 (GRCm39) Y103* probably null Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Mphosph10 A T 7: 64,035,567 (GRCm39) M368K probably damaging Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Suco A T 1: 161,655,809 (GRCm39) M1030K possibly damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in Hsd17b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Hsd17b4 APN 18 50,297,912 (GRCm39) missense probably benign
IGL01369:Hsd17b4 APN 18 50,305,100 (GRCm39) missense possibly damaging 0.95
IGL01411:Hsd17b4 APN 18 50,324,881 (GRCm39) missense probably damaging 1.00
IGL01986:Hsd17b4 APN 18 50,293,193 (GRCm39) splice site probably benign
IGL02126:Hsd17b4 APN 18 50,315,063 (GRCm39) missense probably benign
IGL02496:Hsd17b4 APN 18 50,288,220 (GRCm39) missense probably damaging 0.97
IGL02527:Hsd17b4 APN 18 50,293,231 (GRCm39) missense probably benign 0.00
IGL02553:Hsd17b4 APN 18 50,295,164 (GRCm39) splice site probably benign
IGL02813:Hsd17b4 APN 18 50,261,415 (GRCm39) utr 5 prime probably benign
inauspicious UTSW 18 50,279,491 (GRCm39) missense probably damaging 1.00
I0000:Hsd17b4 UTSW 18 50,293,295 (GRCm39) missense probably benign 0.09
IGL02980:Hsd17b4 UTSW 18 50,279,585 (GRCm39) missense probably benign 0.06
R0352:Hsd17b4 UTSW 18 50,324,851 (GRCm39) missense probably benign
R0734:Hsd17b4 UTSW 18 50,303,844 (GRCm39) missense possibly damaging 0.90
R0967:Hsd17b4 UTSW 18 50,316,328 (GRCm39) missense probably benign 0.00
R1418:Hsd17b4 UTSW 18 50,263,254 (GRCm39) splice site probably benign
R1661:Hsd17b4 UTSW 18 50,293,282 (GRCm39) missense probably benign
R1665:Hsd17b4 UTSW 18 50,293,282 (GRCm39) missense probably benign
R1752:Hsd17b4 UTSW 18 50,303,834 (GRCm39) missense probably benign 0.27
R1804:Hsd17b4 UTSW 18 50,311,051 (GRCm39) missense probably damaging 1.00
R2197:Hsd17b4 UTSW 18 50,316,369 (GRCm39) splice site probably null
R4351:Hsd17b4 UTSW 18 50,275,701 (GRCm39) missense probably damaging 1.00
R4405:Hsd17b4 UTSW 18 50,261,381 (GRCm39) start gained probably benign
R4976:Hsd17b4 UTSW 18 50,293,202 (GRCm39) missense probably damaging 1.00
R5788:Hsd17b4 UTSW 18 50,306,776 (GRCm39) missense probably damaging 0.99
R5826:Hsd17b4 UTSW 18 50,316,239 (GRCm39) missense probably benign 0.00
R5889:Hsd17b4 UTSW 18 50,310,276 (GRCm39) missense probably damaging 1.00
R6475:Hsd17b4 UTSW 18 50,305,329 (GRCm39) splice site probably null
R7151:Hsd17b4 UTSW 18 50,261,437 (GRCm39) missense probably damaging 1.00
R7367:Hsd17b4 UTSW 18 50,288,252 (GRCm39) missense probably damaging 1.00
R7383:Hsd17b4 UTSW 18 50,297,917 (GRCm39) missense probably benign 0.13
R7397:Hsd17b4 UTSW 18 50,279,491 (GRCm39) missense probably damaging 1.00
R7509:Hsd17b4 UTSW 18 50,297,749 (GRCm39) missense probably damaging 1.00
R7697:Hsd17b4 UTSW 18 50,263,208 (GRCm39) missense probably damaging 1.00
R7722:Hsd17b4 UTSW 18 50,279,591 (GRCm39) missense probably damaging 1.00
R7764:Hsd17b4 UTSW 18 50,279,482 (GRCm39) nonsense probably null
R8065:Hsd17b4 UTSW 18 50,303,819 (GRCm39) missense possibly damaging 0.90
R8264:Hsd17b4 UTSW 18 50,279,593 (GRCm39) missense possibly damaging 0.79
R8350:Hsd17b4 UTSW 18 50,297,734 (GRCm39) missense probably benign 0.00
R8450:Hsd17b4 UTSW 18 50,297,734 (GRCm39) missense probably benign 0.00
R9345:Hsd17b4 UTSW 18 50,299,981 (GRCm39) missense probably benign 0.04
R9654:Hsd17b4 UTSW 18 50,272,533 (GRCm39) missense probably benign 0.01
R9705:Hsd17b4 UTSW 18 50,324,791 (GRCm39) missense probably benign 0.41
R9790:Hsd17b4 UTSW 18 50,324,907 (GRCm39) critical splice donor site probably null
R9791:Hsd17b4 UTSW 18 50,324,907 (GRCm39) critical splice donor site probably null
Z1177:Hsd17b4 UTSW 18 50,315,047 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGTTTGTCTCGAGCAAAAGC -3'
(R):5'- TCCCAAGCGTCTCTCAAAGAG -3'

Sequencing Primer
(F):5'- GTCTCGAGCAAAAGCTTCTTG -3'
(R):5'- AGCGTCTCTCAAAGAGTCCTATTAC -3'
Posted On 2018-06-22