Incidental Mutation 'R6601:Ddx28'
ID525267
Institutional Source Beutler Lab
Gene Symbol Ddx28
Ensembl Gene ENSMUSG00000045538
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Synonyms2410004K13Rik, Mddx28
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106009621-106011882 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 106010616 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034375] [ENSMUST00000058579] [ENSMUST00000119736] [ENSMUST00000142898] [ENSMUST00000227778]
PDB Structure
Solution structure of the dsRBD from hypothetical protein BAB26260 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000034375
SMART Domains Protein: ENSMUSP00000034375
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 15 344 1.8e-54 PFAM
DSRM 370 435 1.03e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000058579
AA Change: L270Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058950
Gene: ENSMUSG00000045538
AA Change: L270Q

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
low complexity region 42 58 N/A INTRINSIC
DEXDc 147 365 1.64e-40 SMART
HELICc 411 492 6.89e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119736
SMART Domains Protein: ENSMUSP00000113781
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 1 233 8.1e-38 PFAM
DSRM 257 322 1.03e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141374
Predicted Effect probably benign
Transcript: ENSMUST00000142898
Predicted Effect probably benign
Transcript: ENSMUST00000227778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is intronless. It encodes an RNA-dependent ATPase. The encoded protein is localized in the mitochondria and the nucleus, and can be transported between the mitochondria and the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Ddx28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Ddx28 APN 8 106010580 missense probably damaging 0.97
R0166:Ddx28 UTSW 8 106010289 missense probably benign 0.00
R0329:Ddx28 UTSW 8 106010245 missense probably benign 0.00
R0362:Ddx28 UTSW 8 106011294 missense probably damaging 0.99
R0464:Ddx28 UTSW 8 106010053 missense probably damaging 1.00
R1267:Ddx28 UTSW 8 106009917 missense probably damaging 1.00
R1686:Ddx28 UTSW 8 106010558 missense probably damaging 1.00
R1748:Ddx28 UTSW 8 106010682 missense probably benign 0.01
R2201:Ddx28 UTSW 8 106010574 missense probably damaging 1.00
R4005:Ddx28 UTSW 8 106010928 missense possibly damaging 0.80
R6456:Ddx28 UTSW 8 106010368 missense possibly damaging 0.94
R7295:Ddx28 UTSW 8 106010844 missense probably benign
R7320:Ddx28 UTSW 8 106011325 missense probably damaging 0.96
R7690:Ddx28 UTSW 8 106010331 missense probably damaging 1.00
R8427:Ddx28 UTSW 8 106010280 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTCTGGACTGGTGACTTTACTCAG -3'
(R):5'- AACTAGCCGAACAGGTGCAG -3'

Sequencing Primer
(F):5'- ACTCAGTAACTGGTTTAGGCC -3'
(R):5'- ACAGGTGCAGGCAGTGGC -3'
Posted On2018-06-22