Incidental Mutation 'R6601:Rasgef1c'
ID525279
Institutional Source Beutler Lab
Gene Symbol Rasgef1c
Ensembl Gene ENSMUSG00000020374
Gene NameRasGEF domain family, member 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49901835-49980994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49971419 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 378 (N378K)
Ref Sequence ENSEMBL: ENSMUSP00000090829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063444] [ENSMUST00000093141] [ENSMUST00000093142]
Predicted Effect probably benign
Transcript: ENSMUST00000063444
AA Change: N381K

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065619
Gene: ENSMUSG00000020374
AA Change: N381K

DomainStartEndE-ValueType
Pfam:RasGEF_N 40 141 2.4e-14 PFAM
RasGEF 199 450 4.54e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093141
AA Change: N337K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090828
Gene: ENSMUSG00000020374
AA Change: N337K

DomainStartEndE-ValueType
Blast:RasGEFN 35 123 9e-30 BLAST
RasGEF 155 406 4.54e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093142
AA Change: N378K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090829
Gene: ENSMUSG00000020374
AA Change: N378K

DomainStartEndE-ValueType
Pfam:RasGEF_N 38 138 8.5e-14 PFAM
RasGEF 196 447 4.54e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109172
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Rasgef1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02243:Rasgef1c APN 11 49957390 missense possibly damaging 0.57
IGL02983:Rasgef1c APN 11 49957049 missense possibly damaging 0.95
IGL03076:Rasgef1c APN 11 49970246 missense probably damaging 1.00
IGL03163:Rasgef1c APN 11 49971373 missense possibly damaging 0.96
R0324:Rasgef1c UTSW 11 49961230 critical splice donor site probably null
R1955:Rasgef1c UTSW 11 49975715 missense possibly damaging 0.67
R4204:Rasgef1c UTSW 11 49958708 missense probably benign 0.00
R4705:Rasgef1c UTSW 11 49978467 missense probably benign 0.42
R4952:Rasgef1c UTSW 11 49979512 missense probably damaging 0.99
R5084:Rasgef1c UTSW 11 49969505 missense probably damaging 1.00
R5121:Rasgef1c UTSW 11 49960429 missense probably damaging 1.00
R5564:Rasgef1c UTSW 11 49957107 missense probably benign 0.09
R5801:Rasgef1c UTSW 11 49970056 missense probably damaging 1.00
R5812:Rasgef1c UTSW 11 49957143 missense probably benign 0.01
R7751:Rasgef1c UTSW 11 49970293 missense probably damaging 0.99
R8112:Rasgef1c UTSW 11 49967401 missense probably damaging 1.00
X0027:Rasgef1c UTSW 11 49969502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCACTGATGCTGGGT -3'
(R):5'- AACAACAACAAAAGATGGGGTCT -3'

Sequencing Primer
(F):5'- GTGACCATGGGGCAGGG -3'
(R):5'- TAAGCTAGGCTGACTGTCCATAGAC -3'
Posted On2018-06-22