Incidental Mutation 'R6601:Otop3'
ID525281
Institutional Source Beutler Lab
Gene Symbol Otop3
Ensembl Gene ENSMUSG00000018862
Gene Nameotopetrin 3
Synonyms2310011E08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115334731-115346927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115339847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000102153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000106543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019006
AA Change: V148A

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862
AA Change: V148A

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106543
AA Change: V148A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862
AA Change: V148A

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Otop3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Otop3 APN 11 115344453 missense probably benign
IGL00159:Otop3 APN 11 115344397 missense probably damaging 1.00
IGL01372:Otop3 APN 11 115345104 missense possibly damaging 0.86
IGL01380:Otop3 APN 11 115346411 missense probably damaging 1.00
IGL01960:Otop3 APN 11 115340969 missense probably damaging 0.97
IGL03099:Otop3 APN 11 115339582 missense probably damaging 0.99
F5770:Otop3 UTSW 11 115344838 missense probably damaging 1.00
R1560:Otop3 UTSW 11 115344463 missense possibly damaging 0.89
R2847:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R2849:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R5582:Otop3 UTSW 11 115339339 missense unknown
R6383:Otop3 UTSW 11 115345072 missense probably damaging 0.99
R7001:Otop3 UTSW 11 115339653 missense probably damaging 1.00
R7339:Otop3 UTSW 11 115346378 missense probably damaging 1.00
R7487:Otop3 UTSW 11 115345000 missense probably benign
R7609:Otop3 UTSW 11 115339720 missense possibly damaging 0.63
R7639:Otop3 UTSW 11 115344361 missense possibly damaging 0.94
R7643:Otop3 UTSW 11 115339648 missense probably damaging 1.00
R7820:Otop3 UTSW 11 115339588 missense probably damaging 0.99
R8044:Otop3 UTSW 11 115346435 missense probably damaging 1.00
R8110:Otop3 UTSW 11 115339395 missense probably benign
R8281:Otop3 UTSW 11 115345075 missense possibly damaging 0.88
V7580:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7581:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7582:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7583:Otop3 UTSW 11 115344838 missense probably damaging 1.00
X0022:Otop3 UTSW 11 115339867 missense probably benign 0.01
Z1176:Otop3 UTSW 11 115339844 missense probably damaging 1.00
Z1176:Otop3 UTSW 11 115341012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCCTCTCCCTGTTGTG -3'
(R):5'- TGTCTACACCTCGGGGCATG -3'

Sequencing Primer
(F):5'- GTGGCTCCTCTACTACACAGTGG -3'
(R):5'- ACCTCGGGGCATGGAGAC -3'
Posted On2018-06-22