Incidental Mutation 'R6601:Eif2s1'
ID525283
Institutional Source Beutler Lab
Gene Symbol Eif2s1
Ensembl Gene ENSMUSG00000021116
Gene Nameeukaryotic translation initiation factor 2, subunit 1 alpha
SynonymseIF2alpha, 0910001O23Rik, 2410026C18Rik, Eif2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6601 (G1)
Quality Score157.009
Status Validated
Chromosome12
Chromosomal Location78861819-78887010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78883352 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 258 (I258T)
Ref Sequence ENSEMBL: ENSMUSP00000071214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071230]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071230
AA Change: I258T

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071214
Gene: ENSMUSG00000021116
AA Change: I258T

DomainStartEndE-ValueType
S1 15 88 1.72e-12 SMART
Pfam:EIF_2_alpha 130 244 1e-40 PFAM
coiled coil region 284 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220382
Meta Mutation Damage Score 0.7286 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The translation initiation factor EIF2 catalyzes the first regulated step of protein synthesis initiation, promoting the binding of the initiator tRNA to 40S ribosomal subunits. Binding occurs as a ternary complex of methionyl-tRNA, EIF2, and GTP. EIF2 is composed of 3 nonidentical subunits, the 36-kD EIF2-alpha subunit (EIF2S1), the 38-kD EIF2-beta subunit (EIF2S2; MIM 603908), and the 52-kD EIF2-gamma subunit (EIF2S3; MIM 300161). The rate of formation of the ternary complex is modulated by the phosphorylation state of EIF2-alpha (Ernst et al., 1987 [PubMed 2948954]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knocked-in point mutation die within hours of birth and exhibit hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Eif2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Eif2s1 APN 12 78866646 missense possibly damaging 0.92
IGL00736:Eif2s1 APN 12 78884837 unclassified probably benign
IGL02072:Eif2s1 APN 12 78880014 missense probably benign 0.04
IGL02312:Eif2s1 APN 12 78880016 missense probably damaging 1.00
IGL03379:Eif2s1 APN 12 78866580 missense probably benign 0.00
Sistine UTSW 12 78883352 missense possibly damaging 0.71
R0669:Eif2s1 UTSW 12 78881238 splice site probably benign
R1426:Eif2s1 UTSW 12 78881168 missense probably benign 0.01
R1644:Eif2s1 UTSW 12 78866521 splice site probably null
R1998:Eif2s1 UTSW 12 78866734 missense possibly damaging 0.90
R2069:Eif2s1 UTSW 12 78877185 missense probably benign 0.03
R3885:Eif2s1 UTSW 12 78881225 missense probably damaging 1.00
R4704:Eif2s1 UTSW 12 78877170 missense probably benign 0.31
R4964:Eif2s1 UTSW 12 78880011 missense probably benign
R5908:Eif2s1 UTSW 12 78880043 missense probably damaging 0.99
R6473:Eif2s1 UTSW 12 78881225 missense probably damaging 1.00
R7043:Eif2s1 UTSW 12 78877108 missense probably damaging 0.99
R7358:Eif2s1 UTSW 12 78881195 missense probably damaging 1.00
R8516:Eif2s1 UTSW 12 78881162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGGTCAAGATGATTTCTTC -3'
(R):5'- GTCAGTGTACCTGGGCATAC -3'

Sequencing Primer
(F):5'- GGTCAAGATGATTTCTTCATGTAGC -3'
(R):5'- TCATCAGGCAGTTCAAGGCTAGC -3'
Posted On2018-06-22