Mutagenetix > Incidental Mutations

Incidental Mutation 'R6601:Klhl3'

525289

Institutional Source

Beutler Lab

Gene Symbol

Klhl3

Ensembl Gene

ENSMUSG00000014164

Gene Name

kelch-like 3

Synonyms

EG627648, 7530408C15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6601 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58000228-58113592 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 58095116 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 91 (K91N)

Ref Sequence

ENSEMBL: ENSMUSP00000089173 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091583] [ENSMUST00000160860]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091583
AA Change: K91N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000089173
Gene: ENSMUSG00000014164
AA Change: K91N

Domain	Start	End	E-Value	Type
BTB	103	200	9.36e-30	SMART
BACK	205	307	7.49e-42	SMART
Kelch	355	400	3.31e-9	SMART
Kelch	401	447	3.82e-14	SMART
Kelch	448	494	1.49e-16	SMART
Kelch	495	543	8.58e-17	SMART
Kelch	544	590	4.93e-17	SMART
Kelch	591	638	4.16e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160860
AA Change: K38N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000123701
Gene: ENSMUSG00000014164
AA Change: K38N

Domain	Start	End	E-Value	Type
BTB	64	161	9.36e-30	SMART
BACK	166	268	7.49e-42	SMART
Kelch	316	361	3.31e-9	SMART
Kelch	362	408	3.82e-14	SMART
Kelch	409	455	1.49e-16	SMART
Kelch	456	504	8.58e-17	SMART
Kelch	505	551	4.93e-17	SMART
Kelch	552	599	4.16e-15	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a point mutation display salt-sensitive hypertension, hyperkalemia and metabolic acidosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	T	G	1: 58,063,506	L527R	probably damaging	Het
Ccdc172	T	A	19: 58,537,291	C194S	possibly damaging	Het
Ccnb1ip1	G	T	14: 50,793,664	T64K	possibly damaging	Het
Ces1b	T	C	8: 93,079,481	E44G	probably benign	Het
Coro2a	A	T	4: 46,543,421	Y317*	probably null	Het
Csnk1a1	T	C	18: 61,578,758	F281S	probably damaging	Het
Ddx28	A	T	8: 106,010,616		probably null	Het
Dtnbp1	A	G	13: 44,931,245		probably null	Het
Eif2s1	T	C	12: 78,883,352	I258T	possibly damaging	Het
Elp3	T	C	14: 65,547,039	*554W	probably null	Het
Golga1	T	C	2: 39,020,106	M610V	probably damaging	Het
Hc	T	A	2: 35,045,894	K156N	probably benign	Het
Hcls1	G	A	16: 36,962,386	G428D	probably benign	Het
Il16	T	C	7: 83,722,469	D43G	probably damaging	Het
L3mbtl1	C	T	2: 162,948,175		probably benign	Het
Lamc3	T	C	2: 31,920,532	F805L	possibly damaging	Het
Lipg	T	C	18: 74,948,204	M269V	probably benign	Het
Ly75	G	A	2: 60,318,376	T1203I	probably benign	Het
Mat1a	T	A	14: 41,105,604	V5E	probably benign	Het
Muc16	A	T	9: 18,637,570	L5809Q	probably benign	Het
Naip6	G	A	13: 100,283,758	R1335C	probably benign	Het
Ndufaf3	T	C	9: 108,566,217	H128R	probably benign	Het
Nphp4	A	T	4: 152,503,007		probably null	Het
Olfr52	T	A	2: 86,181,965	I49F	probably damaging	Het
Otop3	T	C	11: 115,339,847	V148A	probably damaging	Het
Ovgp1	T	C	3: 105,986,431		probably benign	Het
Pcsk5	T	G	19: 17,511,380	R1025S	probably benign	Het
Pkd1l2	T	C	8: 117,040,666	D1295G	probably benign	Het
Polr1d	T	A	5: 147,078,549	L14*	probably null	Het
Rab26	T	A	17: 24,529,621	K270*	probably null	Het
Rasgef1c	T	A	11: 49,971,419	N378K	probably damaging	Het
Rpl7a	T	C	2: 26,911,524	V76A	probably benign	Het
Samd9l	T	A	6: 3,377,229	I11F	possibly damaging	Het
Smarca2	C	A	19: 26,654,377	Q531K	probably benign	Het
Styxl1	C	G	5: 135,755,496	G211A	probably benign	Het
Taar9	T	C	10: 24,109,047	Y163C	probably damaging	Het
Tmem198	T	A	1: 75,480,373	F48I	possibly damaging	Het
Ttn	T	A	2: 76,764,729	N12032I	probably damaging	Het
Ubr7	T	A	12: 102,761,464	C82S	probably damaging	Het
Wwtr1	T	C	3: 57,575,738	E48G	possibly damaging	Het
Zfp108	T	C	7: 24,261,394	V470A	probably damaging	Het
Zfp612	C	A	8: 110,089,549	Q424K	possibly damaging	Het
Zscan4-ps1	T	C	7: 11,068,834	T13A	probably benign	Het

Other mutations in Klhl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01790:Klhl3	APN	13	58009422	critical splice acceptor site	probably null
IGL01984:Klhl3	APN	13	58011243	splice site	probably benign
IGL02022:Klhl3	APN	13	58051064	missense	possibly damaging	0.95
IGL02543:Klhl3	APN	13	58018871	missense	probably damaging	1.00
bearded_dragon	UTSW	13	58011152	missense	probably benign	0.00
R0975:Klhl3	UTSW	13	58013863	missense	possibly damaging	0.81
R1386:Klhl3	UTSW	13	58030433	missense	probably damaging	0.99
R1588:Klhl3	UTSW	13	58013898	missense	probably damaging	1.00
R1791:Klhl3	UTSW	13	58033230	missense	possibly damaging	0.87
R1894:Klhl3	UTSW	13	58009375	missense	probably damaging	1.00
R1953:Klhl3	UTSW	13	58011208	missense	probably damaging	1.00
R2116:Klhl3	UTSW	13	58018991	missense	probably damaging	0.99
R3114:Klhl3	UTSW	13	58051027	critical splice donor site	probably null
R4082:Klhl3	UTSW	13	58018797	missense	probably null	1.00
R4717:Klhl3	UTSW	13	58030516	missense	probably damaging	1.00
R4857:Klhl3	UTSW	13	58018806	missense	probably damaging	1.00
R4934:Klhl3	UTSW	13	58102417	nonsense	probably null
R5112:Klhl3	UTSW	13	58018889	missense	probably damaging	1.00
R5114:Klhl3	UTSW	13	58018967	missense	probably benign	0.24
R5547:Klhl3	UTSW	13	58102429	unclassified	probably null
R5776:Klhl3	UTSW	13	58005184	missense	probably benign	0.00
R6236:Klhl3	UTSW	13	58085062	missense	probably damaging	1.00
R6268:Klhl3	UTSW	13	58013842	missense	probably damaging	1.00
R6457:Klhl3	UTSW	13	58100378	missense	probably benign	0.01
R6559:Klhl3	UTSW	13	58016476	missense	probably damaging	1.00
R6580:Klhl3	UTSW	13	58018887	missense	possibly damaging	0.75
R6669:Klhl3	UTSW	13	58011152	missense	probably benign	0.00
R6904:Klhl3	UTSW	13	58030445	missense	probably damaging	1.00
R7652:Klhl3	UTSW	13	58113332	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGCCTCAGAGTCTGAAAGATAG -3'
(R):5'- TACTCGGTCAGTCGAAGGAC -3'

Sequencing Primer
(F):5'- CCTCAGAGTCTGAAAGATAGAAGGG -3'
(R):5'- TGTGCACTGGAAGGTCAC -3'

Posted On

2018-06-22