Incidental Mutation 'R6601:Klhl3'
ID525289
Institutional Source Beutler Lab
Gene Symbol Klhl3
Ensembl Gene ENSMUSG00000014164
Gene Namekelch-like 3
SynonymsEG627648, 7530408C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location58000228-58113592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58095116 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 91 (K91N)
Ref Sequence ENSEMBL: ENSMUSP00000089173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091583] [ENSMUST00000160860]
Predicted Effect probably damaging
Transcript: ENSMUST00000091583
AA Change: K91N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089173
Gene: ENSMUSG00000014164
AA Change: K91N

DomainStartEndE-ValueType
BTB 103 200 9.36e-30 SMART
BACK 205 307 7.49e-42 SMART
Kelch 355 400 3.31e-9 SMART
Kelch 401 447 3.82e-14 SMART
Kelch 448 494 1.49e-16 SMART
Kelch 495 543 8.58e-17 SMART
Kelch 544 590 4.93e-17 SMART
Kelch 591 638 4.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160860
AA Change: K38N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123701
Gene: ENSMUSG00000014164
AA Change: K38N

DomainStartEndE-ValueType
BTB 64 161 9.36e-30 SMART
BACK 166 268 7.49e-42 SMART
Kelch 316 361 3.31e-9 SMART
Kelch 362 408 3.82e-14 SMART
Kelch 409 455 1.49e-16 SMART
Kelch 456 504 8.58e-17 SMART
Kelch 505 551 4.93e-17 SMART
Kelch 552 599 4.16e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a point mutation display salt-sensitive hypertension, hyperkalemia and metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Klhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Klhl3 APN 13 58009422 critical splice acceptor site probably null
IGL01984:Klhl3 APN 13 58011243 splice site probably benign
IGL02022:Klhl3 APN 13 58051064 missense possibly damaging 0.95
IGL02543:Klhl3 APN 13 58018871 missense probably damaging 1.00
bearded_dragon UTSW 13 58011152 missense probably benign 0.00
R0975:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R1386:Klhl3 UTSW 13 58030433 missense probably damaging 0.99
R1588:Klhl3 UTSW 13 58013898 missense probably damaging 1.00
R1791:Klhl3 UTSW 13 58033230 missense possibly damaging 0.87
R1894:Klhl3 UTSW 13 58009375 missense probably damaging 1.00
R1953:Klhl3 UTSW 13 58011208 missense probably damaging 1.00
R2116:Klhl3 UTSW 13 58018991 missense probably damaging 0.99
R3114:Klhl3 UTSW 13 58051027 critical splice donor site probably null
R4082:Klhl3 UTSW 13 58018797 missense probably null 1.00
R4717:Klhl3 UTSW 13 58030516 missense probably damaging 1.00
R4857:Klhl3 UTSW 13 58018806 missense probably damaging 1.00
R4934:Klhl3 UTSW 13 58102417 nonsense probably null
R5112:Klhl3 UTSW 13 58018889 missense probably damaging 1.00
R5114:Klhl3 UTSW 13 58018967 missense probably benign 0.24
R5547:Klhl3 UTSW 13 58102429 unclassified probably null
R5776:Klhl3 UTSW 13 58005184 missense probably benign 0.00
R6236:Klhl3 UTSW 13 58085062 missense probably damaging 1.00
R6268:Klhl3 UTSW 13 58013842 missense probably damaging 1.00
R6457:Klhl3 UTSW 13 58100378 missense probably benign 0.01
R6559:Klhl3 UTSW 13 58016476 missense probably damaging 1.00
R6580:Klhl3 UTSW 13 58018887 missense possibly damaging 0.75
R6669:Klhl3 UTSW 13 58011152 missense probably benign 0.00
R6904:Klhl3 UTSW 13 58030445 missense probably damaging 1.00
R7652:Klhl3 UTSW 13 58113332 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCTCAGAGTCTGAAAGATAG -3'
(R):5'- TACTCGGTCAGTCGAAGGAC -3'

Sequencing Primer
(F):5'- CCTCAGAGTCTGAAAGATAGAAGGG -3'
(R):5'- TGTGCACTGGAAGGTCAC -3'
Posted On2018-06-22