Mutagenetix > Incidental Mutations

Incidental Mutation 'R6633:Tpcn1'

525292

Institutional Source

Beutler Lab

Gene Symbol

Tpcn1

Ensembl Gene

ENSMUSG00000032741

Gene Name

two pore channel 1

Synonyms

5730403B01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6633 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120534153-120588673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120544464 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 493 (M493T)

Ref Sequence

ENSEMBL: ENSMUSP00000042188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046426]

Predicted Effect

probably benign
Transcript: ENSMUST00000046426
AA Change: M493T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: M493T

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	106	332	1.5e-30	PFAM
Pfam:Ion_trans	441	695	1.2e-31	PFAM
SCOP:d1fxkc_	713	795	2e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200708

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatf	C	A	11: 84,511,482		probably null	Het
Acot7	C	T	4: 152,178,259	P30L	probably benign	Het
Adam24	T	G	8: 40,680,487	D331E	probably benign	Het
Adamdec1	T	C	14: 68,573,152	D185G	probably benign	Het
Adgrg7	T	C	16: 56,730,286	I688V	probably benign	Het
Adgrv1	A	T	13: 81,568,643	F779I	probably damaging	Het
Agtr1a	A	G	13: 30,381,467	I172V	probably benign	Het
Anapc4	C	T	5: 52,865,946	H710Y	possibly damaging	Het
Arf1	T	C	11: 59,212,544	N179S	probably benign	Het
Arhgef40	C	T	14: 51,997,431	P1064S	probably damaging	Het
Btnl1	A	G	17: 34,385,331	N362S	possibly damaging	Het
Ccdc80	T	C	16: 45,094,908	F9S	possibly damaging	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cdh2	A	T	18: 16,640,548	N241K	probably benign	Het
Cdk8	C	A	5: 146,298,846	S261*	probably null	Het
Csf2rb2	T	C	15: 78,288,952	E236G	probably benign	Het
Dgcr8	A	T	16: 18,284,182	S79T	possibly damaging	Het
Dnah5	A	T	15: 28,293,787	Y1346F	probably benign	Het
Dock6	A	G	9: 21,820,331	V1194A	probably benign	Het
Dock6	A	G	9: 21,821,503	S1129P	probably damaging	Het
Ephb2	C	G	4: 136,683,996	S451T	probably benign	Het
Esco1	T	A	18: 10,595,738		probably benign	Het
Fcer1a	C	G	1: 173,226,726		probably null	Het
Gbx2	TCCCCC	TCCCCCC	1: 89,928,720		probably null	Het
Gm44511	T	A	6: 128,826,242	D2V	probably damaging	Het
H2-Q2	A	G	17: 35,342,387	T19A	probably damaging	Het
Herc1	G	T	9: 66,439,252	E1967*	probably null	Het
Hic1	G	T	11: 75,169,498	H8N	unknown	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Jarid2	C	A	13: 44,884,877	H84N	probably damaging	Het
Klk1b27	A	T	7: 44,055,810	I134F	probably damaging	Het
Kprp	T	C	3: 92,825,293	Y150C	probably damaging	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp10	T	C	14: 54,469,074	V489A	probably benign	Het
Mrgpra6	A	G	7: 47,188,745	I235T	possibly damaging	Het
Naip1	A	G	13: 100,423,076	M1140T	probably benign	Het
Naip1	C	T	13: 100,423,085	R1137Q	probably benign	Het
Olfr1259	T	C	2: 89,943,366	I250V	probably benign	Het
Plcl2	A	G	17: 50,640,140	I1016V	probably benign	Het
Plekhb1	A	G	7: 100,645,639	Y122H	probably damaging	Het
Polr2a	A	G	11: 69,735,513	S1604P	possibly damaging	Het
Ppp6r2	G	A	15: 89,253,255		probably null	Het
Rag1	T	A	2: 101,642,710	R696W	probably damaging	Het
Rusc2	T	C	4: 43,414,852	F53L	probably damaging	Het
Tango6	T	C	8: 106,718,005	V514A	probably benign	Het
Tex30	A	C	1: 44,087,924	H64Q	probably benign	Het
Tmbim7	A	G	5: 3,657,659		probably null	Het
Tmem5	G	A	10: 122,097,053	R7W	probably damaging	Het
Tpx2	T	G	2: 152,867,354	F35V	probably damaging	Het
Vmn1r3	G	A	4: 3,184,971	T112I	probably benign	Het
Wnt2b	T	C	3: 104,951,056	Y299C	probably damaging	Het

Other mutations in Tpcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Tpcn1	APN	5	120545305	missense	probably damaging	0.99
IGL00551:Tpcn1	APN	5	120560325	missense	probably benign	0.31
IGL02197:Tpcn1	APN	5	120553531	missense	probably damaging	1.00
IGL02584:Tpcn1	APN	5	120539032	missense	probably damaging	0.99
IGL03064:Tpcn1	APN	5	120537566	missense	possibly damaging	0.90
PIT1430001:Tpcn1	UTSW	5	120548323	splice site	probably benign
R0295:Tpcn1	UTSW	5	120539060	missense	probably damaging	1.00
R0316:Tpcn1	UTSW	5	120539259	missense	probably damaging	1.00
R1577:Tpcn1	UTSW	5	120544420	missense	probably damaging	1.00
R1660:Tpcn1	UTSW	5	120549515	missense	possibly damaging	0.82
R1819:Tpcn1	UTSW	5	120536227	splice site	probably null
R2051:Tpcn1	UTSW	5	120543388	missense	probably damaging	1.00
R2364:Tpcn1	UTSW	5	120553494	nonsense	probably null
R2497:Tpcn1	UTSW	5	120538998	splice site	probably null
R3965:Tpcn1	UTSW	5	120556575	missense	probably damaging	0.98
R3972:Tpcn1	UTSW	5	120553752	critical splice donor site	probably null
R4062:Tpcn1	UTSW	5	120557897	missense	possibly damaging	0.82
R4343:Tpcn1	UTSW	5	120560220	missense	probably damaging	1.00
R4422:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4423:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4424:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4655:Tpcn1	UTSW	5	120539257	missense	probably damaging	0.98
R4831:Tpcn1	UTSW	5	120553489	missense	probably damaging	1.00
R4910:Tpcn1	UTSW	5	120556519	missense	probably damaging	0.98
R4948:Tpcn1	UTSW	5	120556531	missense	probably benign	0.15
R4965:Tpcn1	UTSW	5	120547487	missense	possibly damaging	0.82
R4976:Tpcn1	UTSW	5	120560322	missense	probably benign
R5071:Tpcn1	UTSW	5	120548269	critical splice donor site	probably null
R5165:Tpcn1	UTSW	5	120557945	missense	probably damaging	1.00
R5210:Tpcn1	UTSW	5	120539214	missense	probably damaging	1.00
R5910:Tpcn1	UTSW	5	120547397	intron	probably benign
R5939:Tpcn1	UTSW	5	120539827	missense	probably damaging	1.00
R6364:Tpcn1	UTSW	5	120553810	missense	probably damaging	1.00
R6650:Tpcn1	UTSW	5	120537562	missense	probably null	0.50
R6885:Tpcn1	UTSW	5	120544437	missense	probably benign	0.21
R7038:Tpcn1	UTSW	5	120585277	missense	probably damaging	0.99
R7247:Tpcn1	UTSW	5	120585250	missense	possibly damaging	0.63
R7594:Tpcn1	UTSW	5	120556530	missense	possibly damaging	0.67
R7629:Tpcn1	UTSW	5	120537937	missense	probably benign	0.00
R7854:Tpcn1	UTSW	5	120549588	missense	probably damaging	1.00
R8478:Tpcn1	UTSW	5	120560321	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGCAGACAGATCTTGCTG -3'
(R):5'- ATCCACCATGTATCAGCCTTG -3'

Sequencing Primer
(F):5'- ACAGATCTTGCTGTCCTCTGCAC -3'
(R):5'- ATGTATCAGCCTTGCTTCTAGCTGG -3'

Posted On

2018-06-22