Incidental Mutation 'R6601:Mat1a'
ID525293
Institutional Source Beutler Lab
Gene Symbol Mat1a
Ensembl Gene ENSMUSG00000037798
Gene Namemethionine adenosyltransferase I, alpha
SynonymsAms, SAMS, MAT, SAMS1, MATA1, AdoMet
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location41105035-41124412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41105604 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 5 (V5E)
Ref Sequence ENSEMBL: ENSMUSP00000153488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047286] [ENSMUST00000224514] [ENSMUST00000225720]
Predicted Effect probably benign
Transcript: ENSMUST00000047286
AA Change: V5E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044288
Gene: ENSMUSG00000037798
AA Change: V5E

DomainStartEndE-ValueType
Pfam:S-AdoMet_synt_N 18 116 1.4e-44 PFAM
Pfam:S-AdoMet_synt_M 130 251 3.1e-46 PFAM
Pfam:S-AdoMet_synt_C 253 390 1.6e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224514
AA Change: V5E

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000225720
AA Change: V5E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a member of the AdoMet synthase family. Methionine adenosyltransferase is a product of this gene (the alpha form) and the beta form and catalyzes the formation of S-adenosylmethionine from methionine and ATP.[provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene have significantly elevated levels of methionine in the circulation and develop liver steatosis with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Mat1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Mat1a APN 14 41105694 splice site probably benign
IGL01506:Mat1a APN 14 41109438 missense probably damaging 1.00
IGL01616:Mat1a APN 14 41109479 missense probably damaging 1.00
IGL01701:Mat1a APN 14 41114815 missense probably benign
IGL01921:Mat1a APN 14 41114335 splice site probably benign
IGL02681:Mat1a APN 14 41122496 splice site probably benign
IGL03294:Mat1a APN 14 41105604 missense probably benign 0.21
ANU74:Mat1a UTSW 14 41111142 missense probably benign 0.12
R0102:Mat1a UTSW 14 41120230 splice site probably benign
R1445:Mat1a UTSW 14 41121840 missense probably damaging 1.00
R1917:Mat1a UTSW 14 41121437 missense probably damaging 1.00
R1968:Mat1a UTSW 14 41111034 missense probably damaging 1.00
R2518:Mat1a UTSW 14 41122512 missense probably benign 0.00
R3692:Mat1a UTSW 14 41121381 missense probably damaging 0.99
R6546:Mat1a UTSW 14 41121422 missense probably damaging 1.00
R7459:Mat1a UTSW 14 41120184 missense probably benign 0.11
R7657:Mat1a UTSW 14 41122519 nonsense probably null
Z1176:Mat1a UTSW 14 41105510 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTCATATGCTCATAGGCAC -3'
(R):5'- GGTGACACCTTTACAACCAGC -3'

Sequencing Primer
(F):5'- ATGCTCATAGGCACTTAGGC -3'
(R):5'- GTCTCTACAGCAATGGATGAACCTTG -3'
Posted On2018-06-22