Incidental Mutation 'R6601:Ccnb1ip1'
ID525295
Institutional Source Beutler Lab
Gene Symbol Ccnb1ip1
Ensembl Gene ENSMUSG00000071470
Gene Namecyclin B1 interacting protein 1
Synonymsmei4, Hei10, LOC239083
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001111119.1; MGI:2685134

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50789248-50807732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 50793664 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 64 (T64K)
Ref Sequence ENSEMBL: ENSMUSP00000093622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095932] [ENSMUST00000227614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095932
AA Change: T64K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093622
Gene: ENSMUSG00000071470
AA Change: T64K

DomainStartEndE-ValueType
Pfam:zf-RING_5 9 53 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227614
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype Strain: 3050548
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HEI10 is a member of the E3 ubiquitin ligase family and functions in progression of the cell cycle through G(2)/M.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced mutation have abnormal testicular and ovarian morphology and exhibit sterility in both sexes owing to meiotic defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Ccnb1ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Ccnb1ip1 APN 14 50792099 missense probably damaging 1.00
R0069:Ccnb1ip1 UTSW 14 81519382 nonsense probably null
R1164:Ccnb1ip1 UTSW 14 50792137 missense possibly damaging 0.65
R1328:Ccnb1ip1 UTSW 14 50789925 missense probably benign 0.06
R1769:Ccnb1ip1 UTSW 14 50792111 missense probably benign 0.10
R4614:Ccnb1ip1 UTSW 14 50792195 missense probably benign 0.04
R4671:Ccnb1ip1 UTSW 14 50792277 nonsense probably null
R4752:Ccnb1ip1 UTSW 14 50793665 missense possibly damaging 0.64
R4913:Ccnb1ip1 UTSW 14 50792144 nonsense probably null
R5974:Ccnb1ip1 UTSW 14 50792205 missense probably benign 0.00
R7078:Ccnb1ip1 UTSW 14 50792267 nonsense probably null
R7284:Ccnb1ip1 UTSW 14 50792279 missense probably damaging 1.00
R7881:Ccnb1ip1 UTSW 14 50793820 missense possibly damaging 0.83
R8200:Ccnb1ip1 UTSW 14 50792293 missense probably benign 0.01
R8509:Ccnb1ip1 UTSW 14 50792257 missense probably benign
Z1176:Ccnb1ip1 UTSW 14 50792104 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTGGCCTATCAGGTATCTTCG -3'
(R):5'- ACATGCTGCTTTGCAATTATCGG -3'

Sequencing Primer
(F):5'- ATCAGGTATCTTCGCATGAGAGCC -3'
(R):5'- GAAGTGTCGGATCAAGCTCTC -3'
Posted On2018-06-22