Incidental Mutation 'R6633:Klk1b27'
ID525298
Institutional Source Beutler Lab
Gene Symbol Klk1b27
Ensembl Gene ENSMUSG00000063177
Gene Namekallikrein 1-related peptidase b27
SynonymsmGK-27, Klk27, Klk21l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44052290-44056712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44055810 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 134 (I134F)
Ref Sequence ENSEMBL: ENSMUSP00000078786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079859]
Predicted Effect probably damaging
Transcript: ENSMUST00000079859
AA Change: I134F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078786
Gene: ENSMUSG00000063177
AA Change: I134F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.87e-97 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Klk1b27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Klk1b27 APN 7 44056143 critical splice donor site probably null
IGL01328:Klk1b27 APN 7 44055879 missense probably damaging 1.00
IGL01552:Klk1b27 APN 7 44054615 missense probably damaging 1.00
IGL01632:Klk1b27 APN 7 44056673 utr 3 prime probably benign
R0574:Klk1b27 UTSW 7 44056101 missense probably damaging 1.00
R4723:Klk1b27 UTSW 7 44056532 missense probably damaging 1.00
R5800:Klk1b27 UTSW 7 44055664 missense probably benign 0.21
R6002:Klk1b27 UTSW 7 44055690 missense probably benign
R6244:Klk1b27 UTSW 7 44054550 missense probably benign 0.05
R6513:Klk1b27 UTSW 7 44055745 missense probably benign 0.00
R6584:Klk1b27 UTSW 7 44054511 missense possibly damaging 0.84
R7074:Klk1b27 UTSW 7 44056553 missense probably damaging 1.00
R7495:Klk1b27 UTSW 7 44056076 missense probably benign
R7830:Klk1b27 UTSW 7 44055726 missense probably benign 0.00
R8002:Klk1b27 UTSW 7 44056021 missense probably benign 0.01
X0024:Klk1b27 UTSW 7 44056593 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGCATAATGTTTGGCTGGG -3'
(R):5'- GCAGGAGCTTGATGAACACAC -3'

Sequencing Primer
(F):5'- TTGGCTGGGCAAAAACAAGCTATTC -3'
(R):5'- CACACACTGAAGATCATTTGGG -3'
Posted On2018-06-22