Incidental Mutation 'R6601:Rab26'
ID525299
Institutional Source Beutler Lab
Gene Symbol Rab26
Ensembl Gene ENSMUSG00000079657
Gene NameRAB26, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24527241-24534210 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 24529621 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 270 (K270*)
Ref Sequence ENSEMBL: ENSMUSP00000135775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035797] [ENSMUST00000061764] [ENSMUST00000176086] [ENSMUST00000176178] [ENSMUST00000176237] [ENSMUST00000176324] [ENSMUST00000176353] [ENSMUST00000176533] [ENSMUST00000177401] [ENSMUST00000176652] [ENSMUST00000177025] [ENSMUST00000177405] [ENSMUST00000177154] [ENSMUST00000177193] [ENSMUST00000176668]
Predicted Effect probably null
Transcript: ENSMUST00000035797
AA Change: K235*
SMART Domains Protein: ENSMUSP00000046089
Gene: ENSMUSG00000079657
AA Change: K235*

DomainStartEndE-ValueType
low complexity region 40 50 N/A INTRINSIC
RAB 68 232 2.84e-101 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061764
SMART Domains Protein: ENSMUSP00000055970
Gene: ENSMUSG00000079657

DomainStartEndE-ValueType
low complexity region 40 50 N/A INTRINSIC
Pfam:Arf 59 145 1.1e-8 PFAM
Pfam:Ras 69 145 6.6e-27 PFAM
Pfam:Roc 69 157 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176025
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176092
Predicted Effect probably benign
Transcript: ENSMUST00000176178
SMART Domains Protein: ENSMUSP00000134808
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176215
Predicted Effect probably benign
Transcript: ENSMUST00000176237
SMART Domains Protein: ENSMUSP00000134946
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 91 124 4.73e-6 SMART
Pfam:zf-TRAF 182 238 8.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176324
Predicted Effect probably benign
Transcript: ENSMUST00000176353
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176533
AA Change: K270*
SMART Domains Protein: ENSMUSP00000135775
Gene: ENSMUSG00000079657
AA Change: K270*

DomainStartEndE-ValueType
low complexity region 75 85 N/A INTRINSIC
RAB 103 267 2.84e-101 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177139
Predicted Effect probably benign
Transcript: ENSMUST00000177401
Predicted Effect probably benign
Transcript: ENSMUST00000176652
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176921
Predicted Effect probably benign
Transcript: ENSMUST00000177025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176361
Predicted Effect probably benign
Transcript: ENSMUST00000177405
SMART Domains Protein: ENSMUSP00000135127
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177441
Predicted Effect probably benign
Transcript: ENSMUST00000177154
SMART Domains Protein: ENSMUSP00000135874
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 110 118 N/A INTRINSIC
RING 131 164 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177193
SMART Domains Protein: ENSMUSP00000135288
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAB protein family, including RAB26, are important regulators of vesicular fusion and trafficking. The RAB family of small G proteins regulates intercellular vesicle trafficking, including exocytosis, endocytosis, and recycling (summary by Seki et al., 2000 [PubMed 11043516]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Rab26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02636:Rab26 APN 17 24533559 missense probably benign 0.01
R0131:Rab26 UTSW 17 24530785 critical splice donor site probably null
R0131:Rab26 UTSW 17 24530785 critical splice donor site probably null
R0132:Rab26 UTSW 17 24530785 critical splice donor site probably null
R0377:Rab26 UTSW 17 24530045 unclassified probably benign
R0567:Rab26 UTSW 17 24529582 missense probably damaging 0.99
R0681:Rab26 UTSW 17 24527966 unclassified probably benign
R5103:Rab26 UTSW 17 24534097 unclassified probably benign
R5226:Rab26 UTSW 17 24534133 unclassified probably benign
R5975:Rab26 UTSW 17 24530399 missense possibly damaging 0.94
R6307:Rab26 UTSW 17 24530098 missense probably damaging 1.00
R6897:Rab26 UTSW 17 24529792 missense probably damaging 1.00
R7122:Rab26 UTSW 17 24530678 missense probably damaging 1.00
R7155:Rab26 UTSW 17 24532289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCATTAGCCTCTGGTGTC -3'
(R):5'- ATGGGCTACCTTTCATGGAGAC -3'

Sequencing Primer
(F):5'- TCTTTGAGAAGACACTAGGGCATCC -3'
(R):5'- TACCTTTCATGGAGACCAGCG -3'
Posted On2018-06-22