Incidental Mutation 'R6601:Csnk1a1'
ID525301
Institutional Source Beutler Lab
Gene Symbol Csnk1a1
Ensembl Gene ENSMUSG00000024576
Gene Namecasein kinase 1, alpha 1
Synonyms4632404G05Rik, CK1a, 5430427P18Rik, 2610208K14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61555274-61590061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61578758 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 281 (F281S)
Ref Sequence ENSEMBL: ENSMUSP00000131687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115246] [ENSMUST00000163205] [ENSMUST00000165123] [ENSMUST00000165721] [ENSMUST00000166990] [ENSMUST00000167187] [ENSMUST00000170862]
Predicted Effect probably damaging
Transcript: ENSMUST00000115246
AA Change: F281S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110901
Gene: ENSMUSG00000024576
AA Change: F281S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.7e-15 PFAM
Pfam:Pkinase 17 292 3.7e-39 PFAM
low complexity region 302 320 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163205
AA Change: F281S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127144
Gene: ENSMUSG00000024576
AA Change: F281S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 2.6e-15 PFAM
Pfam:Pkinase 17 292 5.6e-39 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000164253
AA Change: F93S
SMART Domains Protein: ENSMUSP00000129295
Gene: ENSMUSG00000024576
AA Change: F93S

DomainStartEndE-ValueType
PDB:4JJR|B 2 114 9e-52 PDB
SCOP:d1csn__ 6 114 5e-26 SMART
low complexity region 115 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165123
AA Change: F281S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128871
Gene: ENSMUSG00000024576
AA Change: F281S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.3e-15 PFAM
Pfam:Pkinase 17 292 2.9e-39 PFAM
low complexity region 302 320 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165721
AA Change: F281S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132083
Gene: ENSMUSG00000024576
AA Change: F281S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.5e-15 PFAM
Pfam:Pkinase 17 293 3.2e-39 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166990
AA Change: F281S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131687
Gene: ENSMUSG00000024576
AA Change: F281S

DomainStartEndE-ValueType
Pfam:Pkinase 17 263 1e-28 PFAM
Pfam:Pkinase_Tyr 17 281 1.1e-15 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167187
AA Change: F309S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127463
Gene: ENSMUSG00000024576
AA Change: F309S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 309 1.5e-12 PFAM
Pfam:Pkinase 17 319 1e-37 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170482
Predicted Effect probably damaging
Transcript: ENSMUST00000170862
AA Change: F309S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127265
Gene: ENSMUSG00000024576
AA Change: F309S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 309 1.6e-12 PFAM
Pfam:Pkinase 17 320 1.1e-37 PFAM
low complexity region 330 355 N/A INTRINSIC
Meta Mutation Damage Score 0.9740 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Lipg T C 18: 74,948,204 M269V probably benign Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Csnk1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Csnk1a1 APN 18 61575450 missense probably damaging 1.00
IGL00984:Csnk1a1 APN 18 61575553 splice site probably benign
IGL03107:Csnk1a1 APN 18 61568305 missense probably damaging 1.00
R0513:Csnk1a1 UTSW 18 61576547 missense probably damaging 0.99
R1068:Csnk1a1 UTSW 18 61569563 critical splice donor site probably null
R1511:Csnk1a1 UTSW 18 61585250 intron probably benign
R1855:Csnk1a1 UTSW 18 61575427 splice site probably null
R2944:Csnk1a1 UTSW 18 61578689 missense probably benign 0.02
R4426:Csnk1a1 UTSW 18 61585310 intron probably benign
R4893:Csnk1a1 UTSW 18 61585301 intron probably benign
R5000:Csnk1a1 UTSW 18 61578769 missense probably damaging 1.00
R5070:Csnk1a1 UTSW 18 61555781 missense probably benign 0.02
R5095:Csnk1a1 UTSW 18 61575476 missense probably damaging 1.00
R6523:Csnk1a1 UTSW 18 61555758 missense probably benign 0.01
R7425:Csnk1a1 UTSW 18 61585259 missense unknown
R7617:Csnk1a1 UTSW 18 61585316 missense unknown
R8379:Csnk1a1 UTSW 18 61555854 missense probably benign 0.00
R8411:Csnk1a1 UTSW 18 61555817 missense probably benign 0.00
X0028:Csnk1a1 UTSW 18 61578632 splice site probably null
X0064:Csnk1a1 UTSW 18 61569564 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATAGCCTCCTACAAAGTATGGAAAC -3'
(R):5'- CTCTGGCACTCAAGATTCCC -3'

Sequencing Primer
(F):5'- GAATTGATAGGGGTTTCCTG -3'
(R):5'- GGCACTCAAGATTCCCTAGTTTAAGC -3'
Posted On2018-06-22