Incidental Mutation 'R6601:Lipg'
ID525303
Institutional Source Beutler Lab
Gene Symbol Lipg
Ensembl Gene ENSMUSG00000053846
Gene Namelipase, endothelial
Synonymsendothelial lipase, EL, mEDL, 3110013K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6601 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location74939322-74961263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74948204 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 269 (M269V)
Ref Sequence ENSEMBL: ENSMUSP00000066536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066532]
Predicted Effect probably benign
Transcript: ENSMUST00000066532
AA Change: M269V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066536
Gene: ENSMUSG00000053846
AA Change: M269V

DomainStartEndE-ValueType
Pfam:Lipase 20 344 3.1e-108 PFAM
LH2 347 483 5.66e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has substantial phospholipase activity and may be involved in lipoprotein metabolism and vascular biology. This protein is designated a member of the TG lipase family by its sequence and characteristic lid region which provides substrate specificity for enzymes of the TG lipase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating total cholesterol and HDL as well as decreased monocyte binding to vascular endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 T G 1: 58,063,506 L527R probably damaging Het
Ccdc172 T A 19: 58,537,291 C194S possibly damaging Het
Ccnb1ip1 G T 14: 50,793,664 T64K possibly damaging Het
Ces1b T C 8: 93,079,481 E44G probably benign Het
Coro2a A T 4: 46,543,421 Y317* probably null Het
Csnk1a1 T C 18: 61,578,758 F281S probably damaging Het
Ddx28 A T 8: 106,010,616 probably null Het
Dtnbp1 A G 13: 44,931,245 probably null Het
Eif2s1 T C 12: 78,883,352 I258T possibly damaging Het
Elp3 T C 14: 65,547,039 *554W probably null Het
Golga1 T C 2: 39,020,106 M610V probably damaging Het
Hc T A 2: 35,045,894 K156N probably benign Het
Hcls1 G A 16: 36,962,386 G428D probably benign Het
Il16 T C 7: 83,722,469 D43G probably damaging Het
Klhl3 C A 13: 58,095,116 K91N probably damaging Het
L3mbtl1 C T 2: 162,948,175 probably benign Het
Lamc3 T C 2: 31,920,532 F805L possibly damaging Het
Ly75 G A 2: 60,318,376 T1203I probably benign Het
Mat1a T A 14: 41,105,604 V5E probably benign Het
Muc16 A T 9: 18,637,570 L5809Q probably benign Het
Naip6 G A 13: 100,283,758 R1335C probably benign Het
Ndufaf3 T C 9: 108,566,217 H128R probably benign Het
Nphp4 A T 4: 152,503,007 probably null Het
Olfr52 T A 2: 86,181,965 I49F probably damaging Het
Otop3 T C 11: 115,339,847 V148A probably damaging Het
Ovgp1 T C 3: 105,986,431 probably benign Het
Pcsk5 T G 19: 17,511,380 R1025S probably benign Het
Pkd1l2 T C 8: 117,040,666 D1295G probably benign Het
Polr1d T A 5: 147,078,549 L14* probably null Het
Rab26 T A 17: 24,529,621 K270* probably null Het
Rasgef1c T A 11: 49,971,419 N378K probably damaging Het
Rpl7a T C 2: 26,911,524 V76A probably benign Het
Samd9l T A 6: 3,377,229 I11F possibly damaging Het
Smarca2 C A 19: 26,654,377 Q531K probably benign Het
Styxl1 C G 5: 135,755,496 G211A probably benign Het
Taar9 T C 10: 24,109,047 Y163C probably damaging Het
Tmem198 T A 1: 75,480,373 F48I possibly damaging Het
Ttn T A 2: 76,764,729 N12032I probably damaging Het
Ubr7 T A 12: 102,761,464 C82S probably damaging Het
Wwtr1 T C 3: 57,575,738 E48G possibly damaging Het
Zfp108 T C 7: 24,261,394 V470A probably damaging Het
Zfp612 C A 8: 110,089,549 Q424K possibly damaging Het
Zscan4-ps1 T C 7: 11,068,834 T13A probably benign Het
Other mutations in Lipg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Lipg APN 18 74947971 critical splice donor site probably null
IGL02340:Lipg APN 18 74960875 splice site probably null
IGL02804:Lipg APN 18 74949088 missense probably damaging 0.98
listube UTSW 18 74957236 missense probably benign 0.00
R0094:Lipg UTSW 18 74945846 missense probably benign 0.14
R0172:Lipg UTSW 18 74948174 missense possibly damaging 0.94
R0316:Lipg UTSW 18 74960941 missense probably benign 0.01
R0535:Lipg UTSW 18 74954220 missense probably damaging 1.00
R0567:Lipg UTSW 18 74957369 missense probably benign 0.01
R1171:Lipg UTSW 18 74945823 missense possibly damaging 0.71
R1554:Lipg UTSW 18 74948047 missense probably damaging 1.00
R1611:Lipg UTSW 18 74948059 missense possibly damaging 0.81
R1916:Lipg UTSW 18 74960937 missense probably benign 0.00
R2125:Lipg UTSW 18 74945885 missense probably benign
R4196:Lipg UTSW 18 74945831 missense probably damaging 1.00
R4629:Lipg UTSW 18 74948036 nonsense probably null
R5186:Lipg UTSW 18 74960938 missense probably benign 0.00
R5424:Lipg UTSW 18 74954253 missense probably damaging 1.00
R5708:Lipg UTSW 18 74955434 missense possibly damaging 0.49
R6416:Lipg UTSW 18 74957236 missense probably benign 0.00
R6493:Lipg UTSW 18 74948024 missense probably damaging 0.99
R7199:Lipg UTSW 18 74955584 missense probably benign 0.01
R7857:Lipg UTSW 18 74945820 missense probably damaging 1.00
R7884:Lipg UTSW 18 74948007 missense probably damaging 1.00
Z1177:Lipg UTSW 18 74941340 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTTGAAAGGCATGCCAGC -3'
(R):5'- AGTTCCTCTGTATCTTAGTAGGAGC -3'

Sequencing Primer
(F):5'- ATGCCAGCCCGGGTTTTTAAATAC -3'
(R):5'- CTTAGTAGGAGCTTGGAATACCCC -3'
Posted On2018-06-22