Incidental Mutation 'R6602:Fam168b'
ID525312
Institutional Source Beutler Lab
Gene Symbol Fam168b
Ensembl Gene ENSMUSG00000037503
Gene Namefamily with sequence similarity 168, member B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34813219-34843065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34836741 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 21 (G21V)
Ref Sequence ENSEMBL: ENSMUSP00000139456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000167518] [ENSMUST00000170092] [ENSMUST00000185231] [ENSMUST00000185469] [ENSMUST00000191307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047534
AA Change: G21V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140534
Predicted Effect probably damaging
Transcript: ENSMUST00000167518
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170092
AA Change: G21V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128676
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 201 8.8e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185231
AA Change: G21V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139456
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 90 7.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185279
Predicted Effect probably damaging
Transcript: ENSMUST00000185469
AA Change: G21V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141150
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 66 3.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191307
AA Change: G21V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140573
Gene: ENSMUSG00000037503
AA Change: G21V

DomainStartEndE-ValueType
Pfam:TCRP1 1 206 2.8e-108 PFAM
Meta Mutation Damage Score 0.3811 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Fam168b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Fam168b APN 1 34836802 start codon destroyed probably null 0.58
R0207:Fam168b UTSW 1 34819688 missense probably damaging 0.98
R2008:Fam168b UTSW 1 34819865 critical splice donor site probably null
R4020:Fam168b UTSW 1 34828779 missense possibly damaging 0.71
R4617:Fam168b UTSW 1 34819982 missense possibly damaging 0.90
R5154:Fam168b UTSW 1 34818099 missense possibly damaging 0.83
R6167:Fam168b UTSW 1 34819603 missense probably damaging 1.00
R6600:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6603:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6627:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6628:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6644:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6692:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6705:Fam168b UTSW 1 34828783 missense probably damaging 0.98
R6985:Fam168b UTSW 1 34819708 missense probably damaging 1.00
R7387:Fam168b UTSW 1 34819708 missense probably damaging 1.00
Z1177:Fam168b UTSW 1 34819882 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGTTTGCCCACTGTC -3'
(R):5'- GGAGCAGCAGAAAATACTTTGC -3'

Sequencing Primer
(F):5'- GGTAAAACACTGTTGCCTGC -3'
(R):5'- GCAGCAGAAAATACTTTGCTTTATAG -3'
Posted On2018-06-22