Incidental Mutation 'R6633:Arf1'
ID525315
Institutional Source Beutler Lab
Gene Symbol Arf1
Ensembl Gene ENSMUSG00000048076
Gene NameADP-ribosylation factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location59211412-59228270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59212544 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 179 (N179S)
Ref Sequence ENSEMBL: ENSMUSP00000126120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020719] [ENSMUST00000061242] [ENSMUST00000163300]
Predicted Effect probably benign
Transcript: ENSMUST00000020719
SMART Domains Protein: ENSMUSP00000020719
Gene: ENSMUSG00000020441

DomainStartEndE-ValueType
Pfam:MMtag 8 83 5.7e-34 PFAM
low complexity region 117 135 N/A INTRINSIC
low complexity region 180 208 N/A INTRINSIC
low complexity region 215 224 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061242
AA Change: N179S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079905
Gene: ENSMUSG00000048076
AA Change: N179S

DomainStartEndE-ValueType
ARF 1 181 2.34e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101158
Predicted Effect probably benign
Transcript: ENSMUST00000163300
AA Change: N179S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126120
Gene: ENSMUSG00000048076
AA Change: N179S

DomainStartEndE-ValueType
ARF 1 181 2.34e-143 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factor 1 (ARF1) is a member of the human ARF gene family. The family members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking as activators of phospholipase D. The gene products, including 6 ARF proteins and 11 ARF-like proteins, constitute a family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2 and ARF3), class II (ARF4 and ARF5) and class III (ARF6), and members of each class share a common gene organization. The ARF1 protein is localized to the Golgi apparatus and has a central role in intra-Golgi transport. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die in utero shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Arf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Arf1 APN 11 59213167 missense probably benign 0.00
IGL03268:Arf1 APN 11 59212837 missense possibly damaging 0.49
R0747:Arf1 UTSW 11 59212635 missense probably benign
R5338:Arf1 UTSW 11 59213215 missense probably damaging 1.00
X0028:Arf1 UTSW 11 59212835 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AAACTGCCTCAGTGGAAACAG -3'
(R):5'- CTACCCAGGGTTATTGGCTG -3'

Sequencing Primer
(F):5'- TAAAAACCTGGCTGCAGGCTG -3'
(R):5'- GCTGTTTGTGGTCCCTGCC -3'
Posted On2018-06-22