Mutagenetix > Incidental Mutations

Incidental Mutation 'R6602:Mastl'

525320

Institutional Source

Beutler Lab

Gene Symbol

Mastl

Ensembl Gene

ENSMUSG00000026779

Gene Name

microtubule associated serine/threonine kinase-like

Synonyms

2700091H24Rik, THC2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6602 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23115606-23156024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23132677 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 678 (Y678C)

Ref Sequence

ENSEMBL: ENSMUSP00000028119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028119]

Predicted Effect

probably benign
Transcript: ENSMUST00000028119
AA Change: Y678C

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: Y678C

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:Pkinase_Tyr	34	194	2.6e-24	PFAM
Pfam:Pkinase	34	200	2.3e-39	PFAM
low complexity region	297	313	N/A	INTRINSIC
Pfam:Pkinase	710	821	6.4e-19	PFAM
Pfam:Pkinase_Tyr	714	818	5.1e-6	PFAM
S_TK_X	822	864	2.01e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136207

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	A	G	8: 124,639,254	L250P	probably damaging	Het
4921539E11Rik	T	C	4: 103,255,572	H12R	probably benign	Het
Abca4	A	C	3: 122,138,501	Q268P	probably benign	Het
Adgrf5	T	A	17: 43,450,304	N963K	probably benign	Het
Arl10	A	G	13: 54,578,937	D176G	probably damaging	Het
Btnl1	T	A	17: 34,385,748	M501K	probably damaging	Het
Ccdc162	G	T	10: 41,615,980	T1079K	probably benign	Het
Cd163	T	A	6: 124,311,635	W342R	probably damaging	Het
Cd70	T	C	17: 57,149,562	S14G	probably benign	Het
Chil4	C	A	3: 106,210,590	K121N	probably benign	Het
Csf1r	A	G	18: 61,110,425	D171G	possibly damaging	Het
Cyp4a31	A	T	4: 115,569,707		probably null	Het
D3Ertd254e	G	T	3: 36,164,855	L341F	possibly damaging	Het
Dapk1	A	T	13: 60,749,204	I746F	probably benign	Het
Erbb4	A	G	1: 68,370,503	S192P	probably damaging	Het
Exoc8	C	A	8: 124,896,411	V406L	probably damaging	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
Greb1	A	T	12: 16,709,440	V652E	probably benign	Het
Ift88	A	G	14: 57,507,259	S745G	probably benign	Het
Il18bp	T	C	7: 102,016,030		probably benign	Het
Il6st	A	G	13: 112,504,413	T908A	probably damaging	Het
Klk11	A	G	7: 43,774,774	S6G	probably benign	Het
Msra	A	T	14: 64,123,339	H184Q	probably benign	Het
Muc16	A	C	9: 18,609,476		probably null	Het
Myo3a	T	G	2: 22,577,787	L351R	probably damaging	Het
Npy5r	GCTGTGAAACACTG	GCTG	8: 66,681,540		probably null	Het
Olfr463	T	C	11: 87,893,652	T91A	probably benign	Het
Olfr830	A	G	9: 18,875,849	D174G	possibly damaging	Het
Olfr867	C	T	9: 20,055,046	R139Q	probably benign	Het
Pcdhb18	A	T	18: 37,490,480	I288F	probably damaging	Het
Pitpna	T	G	11: 75,620,315	V238G	possibly damaging	Het
Ppfibp1	T	A	6: 146,978,221	V81E	possibly damaging	Het
Rab11fip2	T	A	19: 59,942,856	T49S	probably damaging	Het
Rsl24d1	T	A	9: 73,113,510	I3N	possibly damaging	Het
Rtn1	T	C	12: 72,219,318	N161S	probably damaging	Het
Shank1	A	G	7: 44,352,336	I1151V	probably benign	Het
Slc34a3	A	G	2: 25,229,209	S550P	probably damaging	Het
Slc4a1ap	A	G	5: 31,527,641	H207R	probably damaging	Het
Sphkap	T	A	1: 83,275,758	K1423N	possibly damaging	Het
Ttn	A	G	2: 76,881,753		probably benign	Het
Ubqln5	T	A	7: 104,129,489	S43C	probably benign	Het
Vps13d	G	A	4: 145,103,664		probably benign	Het
Wwp1	A	T	4: 19,641,816	V413D	probably damaging	Het

Other mutations in Mastl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01080:Mastl	APN	2	23146148	missense	probably damaging	1.00
IGL02103:Mastl	APN	2	23139998	missense	probably benign	0.01
IGL02622:Mastl	APN	2	23132845	missense	probably benign	0.12
IGL02826:Mastl	APN	2	23145409	missense	probably damaging	1.00
IGL02896:Mastl	APN	2	23131767	missense	probably damaging	1.00
IGL03024:Mastl	APN	2	23139919	missense	probably damaging	1.00
IGL03038:Mastl	APN	2	23140615	splice site	probably benign
R0600:Mastl	UTSW	2	23133346	missense	probably benign	0.06
R0712:Mastl	UTSW	2	23150993	missense	probably damaging	1.00
R1168:Mastl	UTSW	2	23133132	missense	probably benign	0.06
R1750:Mastl	UTSW	2	23146081	nonsense	probably null
R1911:Mastl	UTSW	2	23132680	nonsense	probably null
R2051:Mastl	UTSW	2	23132824	missense	possibly damaging	0.49
R2859:Mastl	UTSW	2	23139967	missense	probably damaging	0.99
R3799:Mastl	UTSW	2	23140492	splice site	probably benign
R3840:Mastl	UTSW	2	23140551	missense	probably damaging	1.00
R4807:Mastl	UTSW	2	23132843	missense	probably benign
R4818:Mastl	UTSW	2	23137026	missense	probably benign	0.00
R4845:Mastl	UTSW	2	23139998	missense	probably benign	0.01
R5338:Mastl	UTSW	2	23133491	missense	probably benign	0.01
R5364:Mastl	UTSW	2	23133653	missense	probably benign	0.16
R6077:Mastl	UTSW	2	23155794	missense	probably damaging	0.99
R6158:Mastl	UTSW	2	23132772	missense	possibly damaging	0.92
R6450:Mastl	UTSW	2	23120929	missense	probably damaging	1.00
R6788:Mastl	UTSW	2	23133698	missense	probably benign	0.22
R6908:Mastl	UTSW	2	23155976	start gained	probably benign
R7058:Mastl	UTSW	2	23133413	nonsense	probably null
R7233:Mastl	UTSW	2	23133658	missense	probably benign
R7249:Mastl	UTSW	2	23146139	missense	probably damaging	1.00
R7347:Mastl	UTSW	2	23133389	missense	probably damaging	0.99
R7371:Mastl	UTSW	2	23140573	missense	probably damaging	1.00
R7726:Mastl	UTSW	2	23140795	intron	probably null
R8057:Mastl	UTSW	2	23133554	missense	possibly damaging	0.75
R8288:Mastl	UTSW	2	23133359	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTATCAGCTTCACTTTCATGCATG -3'
(R):5'- GTATCCAAGACAGTAGCCAAGTG -3'

Sequencing Primer
(F):5'- CGTGTCTTAGCAGGTTAC -3'
(R):5'- GTAGCCAAGTGTCAGCTCATC -3'

Posted On

2018-06-22