Incidental Mutation 'R6602:Slc34a3'
ID 525322
Institutional Source Beutler Lab
Gene Symbol Slc34a3
Ensembl Gene ENSMUSG00000006469
Gene Name solute carrier family 34 (sodium phosphate), member 3
Synonyms Npt2c, NPTIIc
Accession Numbers
Essential gene? Probably non essential (E-score: 0.223) question?
Stock # R6602 (G1)
Quality Score 190.009
Status Validated
Chromosome 2
Chromosomal Location 25118909-25124282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25119221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 550 (S550P)
Ref Sequence ENSEMBL: ENSMUSP00000006638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043584]
AlphaFold Q80SU6
Predicted Effect probably damaging
Transcript: ENSMUST00000006638
AA Change: S550P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469
AA Change: S550P

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155420
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypercalciuria, hypercalcemia and increased plasma 1,25(OH)2D3 levels but do not develop hypophosphatemia, renal calcification, rickets, or osteomalacia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Abca4 A C 3: 121,932,150 (GRCm39) Q268P probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Greb1 A T 12: 16,759,441 (GRCm39) V652E probably benign Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Or7g18 A G 9: 18,787,145 (GRCm39) D174G possibly damaging Het
Pcdhb18 A T 18: 37,623,533 (GRCm39) I288F probably damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc4a1ap A G 5: 31,684,985 (GRCm39) H207R probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Ubqln5 T A 7: 103,778,696 (GRCm39) S43C probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,816 (GRCm39) V413D probably damaging Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Slc34a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Slc34a3 APN 2 25,122,275 (GRCm39) missense probably benign 0.01
IGL02885:Slc34a3 APN 2 25,121,069 (GRCm39) missense probably damaging 1.00
IGL03131:Slc34a3 APN 2 25,121,246 (GRCm39) missense probably benign
IGL03166:Slc34a3 APN 2 25,122,186 (GRCm39) missense probably damaging 0.99
IGL03278:Slc34a3 APN 2 25,122,059 (GRCm39) missense probably benign 0.01
PIT4544001:Slc34a3 UTSW 2 25,120,607 (GRCm39) missense probably benign 0.27
R0415:Slc34a3 UTSW 2 25,119,122 (GRCm39) missense probably benign
R0558:Slc34a3 UTSW 2 25,123,077 (GRCm39) unclassified probably benign
R0883:Slc34a3 UTSW 2 25,121,245 (GRCm39) missense probably benign
R2107:Slc34a3 UTSW 2 25,120,999 (GRCm39) missense probably damaging 0.99
R2329:Slc34a3 UTSW 2 25,119,422 (GRCm39) missense possibly damaging 0.95
R3108:Slc34a3 UTSW 2 25,119,257 (GRCm39) missense probably benign
R4637:Slc34a3 UTSW 2 25,119,473 (GRCm39) missense possibly damaging 0.92
R5008:Slc34a3 UTSW 2 25,120,854 (GRCm39) missense possibly damaging 0.62
R5341:Slc34a3 UTSW 2 25,120,671 (GRCm39) missense probably benign 0.00
R5623:Slc34a3 UTSW 2 25,123,312 (GRCm39) splice site probably null
R7512:Slc34a3 UTSW 2 25,122,253 (GRCm39) splice site probably null
R7784:Slc34a3 UTSW 2 25,122,237 (GRCm39) missense probably damaging 1.00
R8072:Slc34a3 UTSW 2 25,119,289 (GRCm39) missense probably benign 0.01
R8730:Slc34a3 UTSW 2 25,122,057 (GRCm39) missense possibly damaging 0.80
R8762:Slc34a3 UTSW 2 25,121,003 (GRCm39) missense probably benign 0.03
R8880:Slc34a3 UTSW 2 25,119,267 (GRCm39) missense probably benign 0.03
Z1176:Slc34a3 UTSW 2 25,119,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCTGAAGCTAGTGGAG -3'
(R):5'- GAAACCTGACTGCCCAGTATCG -3'

Sequencing Primer
(F):5'- AGCTGGCTATGGTACCCAC -3'
(R):5'- GGGTGGCCATTGTCTACCTAC -3'
Posted On 2018-06-22