Incidental Mutation 'R6602:Slc34a3'
ID525322
Institutional Source Beutler Lab
Gene Symbol Slc34a3
Ensembl Gene ENSMUSG00000006469
Gene Namesolute carrier family 34 (sodium phosphate), member 3
SynonymsNPTIIc, Npt2c
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6602 (G1)
Quality Score190.009
Status Validated
Chromosome2
Chromosomal Location25228898-25234364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25229209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 550 (S550P)
Ref Sequence ENSEMBL: ENSMUSP00000006638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043584]
Predicted Effect probably damaging
Transcript: ENSMUST00000006638
AA Change: S550P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469
AA Change: S550P

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155420
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypercalciuria, hypercalcemia and increased plasma 1,25(OH)2D3 levels but do not develop hypophosphatemia, renal calcification, rickets, or osteomalacia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Slc34a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Slc34a3 APN 2 25232263 missense probably benign 0.01
IGL02885:Slc34a3 APN 2 25231057 missense probably damaging 1.00
IGL03131:Slc34a3 APN 2 25231234 missense probably benign
IGL03166:Slc34a3 APN 2 25232174 missense probably damaging 0.99
IGL03278:Slc34a3 APN 2 25232047 missense probably benign 0.01
PIT4544001:Slc34a3 UTSW 2 25230595 missense probably benign 0.27
R0415:Slc34a3 UTSW 2 25229110 missense probably benign
R0558:Slc34a3 UTSW 2 25233065 unclassified probably benign
R0883:Slc34a3 UTSW 2 25231233 missense probably benign
R2107:Slc34a3 UTSW 2 25230987 missense probably damaging 0.99
R2329:Slc34a3 UTSW 2 25229410 missense possibly damaging 0.95
R3108:Slc34a3 UTSW 2 25229245 missense probably benign
R4637:Slc34a3 UTSW 2 25229461 missense possibly damaging 0.92
R5008:Slc34a3 UTSW 2 25230842 missense possibly damaging 0.62
R5341:Slc34a3 UTSW 2 25230659 missense probably benign 0.00
R5623:Slc34a3 UTSW 2 25233300 splice site probably null
R7512:Slc34a3 UTSW 2 25232241 synonymous probably null
R7784:Slc34a3 UTSW 2 25232225 missense probably damaging 1.00
R8072:Slc34a3 UTSW 2 25229277 missense probably benign 0.01
Z1176:Slc34a3 UTSW 2 25229398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCTGAAGCTAGTGGAG -3'
(R):5'- GAAACCTGACTGCCCAGTATCG -3'

Sequencing Primer
(F):5'- AGCTGGCTATGGTACCCAC -3'
(R):5'- GGGTGGCCATTGTCTACCTAC -3'
Posted On2018-06-22