Incidental Mutation 'R6633:Agtr1a'
ID525323
Institutional Source Beutler Lab
Gene Symbol Agtr1a
Ensembl Gene ENSMUSG00000049115
Gene Nameangiotensin II receptor, type 1a
SynonymsAngtr-1a, Agtr1a, Agtr-1a, 1810074K20Rik, AT1, AT1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location30336441-30382867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30381467 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 172 (I172V)
Ref Sequence ENSEMBL: ENSMUSP00000070958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066412] [ENSMUST00000221743] [ENSMUST00000222370] [ENSMUST00000222503] [ENSMUST00000223201]
Predicted Effect probably benign
Transcript: ENSMUST00000066412
AA Change: I172V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000070958
Gene: ENSMUSG00000049115
AA Change: I172V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 316 8.2e-10 PFAM
Pfam:7tm_1 45 302 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221743
Predicted Effect probably benign
Transcript: ENSMUST00000222370
Predicted Effect probably benign
Transcript: ENSMUST00000222503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222575
Predicted Effect probably benign
Transcript: ENSMUST00000223201
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous inactivation of this gene causes hypotension and hyperreninemia, alters drinking behavior and vascular and hemodynamic responses to angiotensin II, and may lead to abnormal physiological response to xenobiotics, abnormal kidney morphology, andreduced cell numbers in specific brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Agtr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Agtr1a APN 13 30381828 missense probably damaging 1.00
IGL01738:Agtr1a APN 13 30381038 missense probably benign 0.00
IGL01870:Agtr1a APN 13 30381327 missense probably damaging 1.00
IGL02293:Agtr1a APN 13 30381357 missense probably benign
IGL03411:Agtr1a APN 13 30381599 missense possibly damaging 0.49
R0012:Agtr1a UTSW 13 30381749 missense probably damaging 0.99
R0148:Agtr1a UTSW 13 30381944 missense probably benign 0.33
R0584:Agtr1a UTSW 13 30381034 missense probably damaging 1.00
R0622:Agtr1a UTSW 13 30381681 missense probably benign 0.00
R0730:Agtr1a UTSW 13 30381296 missense probably damaging 1.00
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R4075:Agtr1a UTSW 13 30381834 missense probably damaging 1.00
R4757:Agtr1a UTSW 13 30381859 nonsense probably null
R5677:Agtr1a UTSW 13 30381584 missense probably damaging 1.00
R5722:Agtr1a UTSW 13 30382033 makesense probably null
R6355:Agtr1a UTSW 13 30381499 missense probably benign 0.04
R7325:Agtr1a UTSW 13 30381907 missense possibly damaging 0.86
R7358:Agtr1a UTSW 13 30380979 missense probably benign 0.05
R7465:Agtr1a UTSW 13 30381981 missense probably benign 0.03
X0025:Agtr1a UTSW 13 30381468 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGTTTCAACCTCTACGCCAG -3'
(R):5'- ATCAGCACATCCAGGAATGTG -3'

Sequencing Primer
(F):5'- AGCGTGTTCCTGCTCAC -3'
(R):5'- GCACATCCAGGAATGTGAATATTTGG -3'
Posted On2018-06-22