Incidental Mutation 'R6602:Chil4'
ID525328
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Namechitinase-like 4
SynonymsYm2, Chi3l4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6602 (G1)
Quality Score190.009
Status Validated
Chromosome3
Chromosomal Location106201490-106219507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106210590 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 121 (K121N)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
Predicted Effect probably benign
Transcript: ENSMUST00000082219
AA Change: K121N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: K121N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196128
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106201797 missense probably benign
IGL02457:Chil4 APN 3 106214399 missense probably benign
R1087:Chil4 UTSW 3 106210565 missense probably benign 0.01
R1398:Chil4 UTSW 3 106219509 unclassified probably null
R1503:Chil4 UTSW 3 106206034 missense probably benign
R1553:Chil4 UTSW 3 106203690 missense probably benign 0.02
R1806:Chil4 UTSW 3 106210643 splice site probably benign
R1873:Chil4 UTSW 3 106206098 missense probably benign 0.00
R2069:Chil4 UTSW 3 106219455 missense probably benign 0.16
R2100:Chil4 UTSW 3 106214347 missense probably benign
R2370:Chil4 UTSW 3 106214300 nonsense probably null
R2984:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106203740 missense probably benign 0.08
R3919:Chil4 UTSW 3 106202532 missense probably benign 0.00
R4033:Chil4 UTSW 3 106214449 missense probably damaging 1.00
R4181:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106202828 missense probably benign
R4391:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106214362 missense probably damaging 1.00
R4544:Chil4 UTSW 3 106210606 missense probably damaging 0.97
R4887:Chil4 UTSW 3 106204144 missense probably benign 0.01
R4949:Chil4 UTSW 3 106206092 missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106202597 missense probably damaging 1.00
R5146:Chil4 UTSW 3 106202834 missense probably benign 0.18
R5254:Chil4 UTSW 3 106219452 missense probably benign 0.00
R5521:Chil4 UTSW 3 106203697 missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106202578 missense probably benign 0.00
R5883:Chil4 UTSW 3 106210570 missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106214395 missense probably damaging 1.00
R6257:Chil4 UTSW 3 106204096 missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106204171 missense probably damaging 1.00
R7113:Chil4 UTSW 3 106202767 missense probably damaging 1.00
R7113:Chil4 UTSW 3 106214348 missense probably benign
R7188:Chil4 UTSW 3 106204159 missense probably damaging 1.00
X0067:Chil4 UTSW 3 106206034 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTGCTGAGATTCTACAATTCTG -3'
(R):5'- TTCTCCAGAACAGACGGTTG -3'

Sequencing Primer
(F):5'- CAATTGACTGACCTGCAC -3'
(R):5'- CAGAACAGACGGTTGTTATATTTTGC -3'
Posted On2018-06-22