Incidental Mutation 'R6602:Abca4'
ID 525330
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene Name ATP-binding cassette, sub-family A member 4
Synonyms Rim protein, RmP, D430003I15Rik, Abc10
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 121838092-121973772 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 121932150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 268 (Q268P)
Ref Sequence ENSEMBL: ENSMUSP00000143560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]
AlphaFold O35600
Predicted Effect probably benign
Transcript: ENSMUST00000013995
AA Change: Q1476P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: Q1476P

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141135
AA Change: Q268P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: Q268P

DomainStartEndE-ValueType
Blast:AAA 1 172 9e-78 BLAST
Pfam:ABC2_membrane_3 311 686 1.9e-42 PFAM
AAA 755 939 1.2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198484
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Greb1 A T 12: 16,759,441 (GRCm39) V652E probably benign Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Or7g18 A G 9: 18,787,145 (GRCm39) D174G possibly damaging Het
Pcdhb18 A T 18: 37,623,533 (GRCm39) I288F probably damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc34a3 A G 2: 25,119,221 (GRCm39) S550P probably damaging Het
Slc4a1ap A G 5: 31,684,985 (GRCm39) H207R probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Ubqln5 T A 7: 103,778,696 (GRCm39) S43C probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,816 (GRCm39) V413D probably damaging Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 121,856,353 (GRCm39) splice site probably null
IGL00229:Abca4 APN 3 121,964,603 (GRCm39) missense probably damaging 1.00
IGL00858:Abca4 APN 3 121,967,537 (GRCm39) missense probably damaging 0.97
IGL01316:Abca4 APN 3 121,935,404 (GRCm39) missense probably damaging 0.99
IGL01357:Abca4 APN 3 121,897,232 (GRCm39) missense probably damaging 1.00
IGL01784:Abca4 APN 3 121,932,154 (GRCm39) missense probably benign 0.22
IGL01903:Abca4 APN 3 121,949,050 (GRCm39) splice site probably benign
IGL02008:Abca4 APN 3 121,969,750 (GRCm39) missense probably benign 0.00
IGL02113:Abca4 APN 3 121,904,127 (GRCm39) missense possibly damaging 0.90
IGL02142:Abca4 APN 3 121,963,575 (GRCm39) missense probably benign 0.01
IGL02200:Abca4 APN 3 121,862,663 (GRCm39) missense probably benign 0.00
IGL02203:Abca4 APN 3 121,973,457 (GRCm39) missense probably benign
IGL02306:Abca4 APN 3 121,952,044 (GRCm39) missense probably damaging 1.00
IGL02307:Abca4 APN 3 121,935,395 (GRCm39) missense probably damaging 1.00
IGL02673:Abca4 APN 3 121,897,150 (GRCm39) missense probably damaging 1.00
IGL02864:Abca4 APN 3 121,937,080 (GRCm39) missense probably damaging 1.00
IGL02886:Abca4 APN 3 121,921,863 (GRCm39) missense probably damaging 0.96
IGL02934:Abca4 APN 3 121,956,008 (GRCm39) nonsense probably null
IGL02992:Abca4 APN 3 121,921,935 (GRCm39) missense probably damaging 0.96
IGL03083:Abca4 APN 3 121,932,261 (GRCm39) critical splice donor site probably null
IGL03258:Abca4 APN 3 121,931,210 (GRCm39) splice site probably benign
IGL03279:Abca4 APN 3 121,935,381 (GRCm39) missense probably benign 0.12
3-1:Abca4 UTSW 3 121,874,574 (GRCm39) missense probably benign 0.01
B6819:Abca4 UTSW 3 121,897,273 (GRCm39) splice site probably benign
K7894:Abca4 UTSW 3 121,941,517 (GRCm39) frame shift probably null
PIT4151001:Abca4 UTSW 3 121,930,670 (GRCm39) missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 121,898,965 (GRCm39) missense probably damaging 0.99
R0001:Abca4 UTSW 3 121,874,660 (GRCm39) splice site probably benign
R0091:Abca4 UTSW 3 121,932,179 (GRCm39) missense possibly damaging 0.94
R0138:Abca4 UTSW 3 121,899,098 (GRCm39) missense probably damaging 1.00
R0344:Abca4 UTSW 3 121,877,613 (GRCm39) missense probably damaging 1.00
R0347:Abca4 UTSW 3 121,913,748 (GRCm39) missense probably benign 0.00
R0508:Abca4 UTSW 3 121,917,200 (GRCm39) splice site probably benign
R0607:Abca4 UTSW 3 121,950,081 (GRCm39) missense probably damaging 1.00
R0835:Abca4 UTSW 3 121,919,862 (GRCm39) missense probably damaging 1.00
R0839:Abca4 UTSW 3 121,920,527 (GRCm39) missense probably damaging 0.99
R1138:Abca4 UTSW 3 121,967,497 (GRCm39) missense probably benign 0.13
R1448:Abca4 UTSW 3 121,956,577 (GRCm39) splice site probably null
R1453:Abca4 UTSW 3 121,862,763 (GRCm39) missense probably benign 0.04
R1533:Abca4 UTSW 3 121,928,807 (GRCm39) missense probably benign 0.07
R1645:Abca4 UTSW 3 121,948,926 (GRCm39) missense probably benign 0.00
R1763:Abca4 UTSW 3 121,957,479 (GRCm39) missense probably damaging 1.00
R1763:Abca4 UTSW 3 121,904,330 (GRCm39) missense probably benign 0.09
R1838:Abca4 UTSW 3 121,921,954 (GRCm39) missense probably benign
R1867:Abca4 UTSW 3 121,899,010 (GRCm39) missense probably damaging 1.00
R1907:Abca4 UTSW 3 121,862,661 (GRCm39) missense probably damaging 0.99
R1935:Abca4 UTSW 3 121,846,572 (GRCm39) missense probably benign 0.00
R1936:Abca4 UTSW 3 121,846,572 (GRCm39) missense probably benign 0.00
R2165:Abca4 UTSW 3 121,906,048 (GRCm39) missense possibly damaging 0.90
R2391:Abca4 UTSW 3 121,952,071 (GRCm39) missense probably benign 0.00
R2403:Abca4 UTSW 3 121,964,592 (GRCm39) missense probably damaging 1.00
R3788:Abca4 UTSW 3 121,846,561 (GRCm39) missense possibly damaging 0.50
R3814:Abca4 UTSW 3 121,964,570 (GRCm39) splice site probably benign
R4554:Abca4 UTSW 3 121,949,992 (GRCm39) missense possibly damaging 0.91
R4649:Abca4 UTSW 3 121,963,542 (GRCm39) missense probably damaging 1.00
R4653:Abca4 UTSW 3 121,932,230 (GRCm39) nonsense probably null
R4655:Abca4 UTSW 3 121,941,147 (GRCm39) missense possibly damaging 0.93
R4668:Abca4 UTSW 3 121,948,948 (GRCm39) missense possibly damaging 0.90
R4705:Abca4 UTSW 3 121,899,019 (GRCm39) missense probably damaging 0.98
R4788:Abca4 UTSW 3 121,960,361 (GRCm39) missense probably damaging 1.00
R4795:Abca4 UTSW 3 121,969,772 (GRCm39) missense probably damaging 0.99
R4999:Abca4 UTSW 3 121,899,019 (GRCm39) missense probably damaging 1.00
R5301:Abca4 UTSW 3 121,896,502 (GRCm39) missense probably damaging 0.96
R5372:Abca4 UTSW 3 121,848,988 (GRCm39) missense probably damaging 0.96
R5395:Abca4 UTSW 3 121,874,590 (GRCm39) missense probably benign 0.00
R5539:Abca4 UTSW 3 121,963,557 (GRCm39) missense probably damaging 1.00
R5583:Abca4 UTSW 3 121,942,550 (GRCm39) missense probably damaging 0.99
R5706:Abca4 UTSW 3 121,847,910 (GRCm39) missense probably benign 0.10
R5719:Abca4 UTSW 3 121,928,915 (GRCm39) critical splice donor site probably null
R5731:Abca4 UTSW 3 121,926,242 (GRCm39) missense probably damaging 1.00
R5802:Abca4 UTSW 3 121,847,881 (GRCm39) missense probably damaging 1.00
R5819:Abca4 UTSW 3 121,930,630 (GRCm39) missense probably damaging 0.97
R5853:Abca4 UTSW 3 121,897,180 (GRCm39) missense probably benign
R6053:Abca4 UTSW 3 121,964,666 (GRCm39) missense probably damaging 0.99
R6135:Abca4 UTSW 3 121,932,096 (GRCm39) missense possibly damaging 0.69
R6185:Abca4 UTSW 3 121,919,789 (GRCm39) missense probably damaging 0.97
R6227:Abca4 UTSW 3 121,930,743 (GRCm39) nonsense probably null
R6293:Abca4 UTSW 3 121,935,395 (GRCm39) missense probably damaging 1.00
R6297:Abca4 UTSW 3 121,926,179 (GRCm39) missense probably benign 0.24
R6367:Abca4 UTSW 3 121,897,229 (GRCm39) missense probably damaging 1.00
R6376:Abca4 UTSW 3 121,917,309 (GRCm39) missense possibly damaging 0.95
R6405:Abca4 UTSW 3 121,967,311 (GRCm39) splice site probably null
R6525:Abca4 UTSW 3 121,931,308 (GRCm39) missense probably benign 0.00
R6681:Abca4 UTSW 3 121,915,447 (GRCm39) missense probably damaging 1.00
R6747:Abca4 UTSW 3 121,919,962 (GRCm39) splice site probably null
R6852:Abca4 UTSW 3 121,928,844 (GRCm39) missense probably damaging 0.99
R7049:Abca4 UTSW 3 121,941,497 (GRCm39) missense probably benign 0.00
R7072:Abca4 UTSW 3 121,967,592 (GRCm39) missense probably damaging 1.00
R7092:Abca4 UTSW 3 121,932,218 (GRCm39) missense probably damaging 1.00
R7110:Abca4 UTSW 3 121,926,292 (GRCm39) missense probably damaging 1.00
R7138:Abca4 UTSW 3 121,899,113 (GRCm39) nonsense probably null
R7172:Abca4 UTSW 3 121,897,189 (GRCm39) nonsense probably null
R7263:Abca4 UTSW 3 121,847,843 (GRCm39) missense probably damaging 0.99
R7414:Abca4 UTSW 3 121,896,387 (GRCm39) missense probably benign 0.28
R7537:Abca4 UTSW 3 121,967,637 (GRCm39) missense possibly damaging 0.68
R7577:Abca4 UTSW 3 121,967,663 (GRCm39) missense probably damaging 1.00
R7665:Abca4 UTSW 3 121,838,139 (GRCm39) start gained probably benign
R7758:Abca4 UTSW 3 121,921,816 (GRCm39) missense probably damaging 1.00
R7935:Abca4 UTSW 3 121,904,186 (GRCm39) missense possibly damaging 0.85
R8237:Abca4 UTSW 3 121,955,952 (GRCm39) missense probably benign 0.00
R8255:Abca4 UTSW 3 121,948,926 (GRCm39) missense probably benign 0.00
R8294:Abca4 UTSW 3 121,897,217 (GRCm39) missense possibly damaging 0.75
R8504:Abca4 UTSW 3 121,922,983 (GRCm39) missense probably benign 0.01
R8536:Abca4 UTSW 3 121,973,394 (GRCm39) missense probably benign 0.01
R8714:Abca4 UTSW 3 121,942,528 (GRCm39) missense probably benign 0.19
R8771:Abca4 UTSW 3 121,880,320 (GRCm39) missense probably damaging 0.97
R8835:Abca4 UTSW 3 121,896,433 (GRCm39) missense probably benign 0.00
R8845:Abca4 UTSW 3 121,930,651 (GRCm39) missense probably damaging 1.00
R8856:Abca4 UTSW 3 121,906,096 (GRCm39) missense probably benign
R8933:Abca4 UTSW 3 121,921,786 (GRCm39) missense probably damaging 1.00
R9052:Abca4 UTSW 3 121,940,908 (GRCm39) missense possibly damaging 0.68
R9095:Abca4 UTSW 3 121,967,556 (GRCm39) missense possibly damaging 0.52
R9221:Abca4 UTSW 3 121,921,828 (GRCm39) missense probably damaging 1.00
R9262:Abca4 UTSW 3 121,964,639 (GRCm39) missense probably damaging 1.00
R9301:Abca4 UTSW 3 121,881,128 (GRCm39) missense probably benign 0.24
R9367:Abca4 UTSW 3 121,838,197 (GRCm39) start codon destroyed probably null 0.99
R9408:Abca4 UTSW 3 121,931,274 (GRCm39) missense probably benign
R9425:Abca4 UTSW 3 121,926,344 (GRCm39) missense probably damaging 1.00
R9464:Abca4 UTSW 3 121,913,714 (GRCm39) missense probably benign 0.08
R9483:Abca4 UTSW 3 121,879,275 (GRCm39) missense
R9751:Abca4 UTSW 3 121,881,126 (GRCm39) missense probably benign 0.00
Z1176:Abca4 UTSW 3 121,950,092 (GRCm39) missense probably damaging 1.00
Z1176:Abca4 UTSW 3 121,897,137 (GRCm39) missense probably damaging 1.00
Z1177:Abca4 UTSW 3 121,967,563 (GRCm39) missense probably benign 0.21
Z1177:Abca4 UTSW 3 121,941,435 (GRCm39) missense possibly damaging 0.79
Z1189:Abca4 UTSW 3 121,877,642 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGCTGCAGTTCTGATAGTCC -3'
(R):5'- TGAGTATCAAACCCAGGGCC -3'

Sequencing Primer
(F):5'- CGAGAGGGAAATTCCTGACTTC -3'
(R):5'- AGGGCCTCATCACTGACAGTC -3'
Posted On 2018-06-22