Incidental Mutation 'R6602:Wwp1'
ID 525332
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene Name WW domain containing E3 ubiquitin protein ligase 1
Synonyms AIP5, 8030445B08Rik, SDRP1, Tiul1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 19608303-19708993 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19641816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 413 (V413D)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
AlphaFold Q8BZZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000035982
AA Change: V413D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: V413D

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108246
AA Change: V413D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: V413D

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Meta Mutation Damage Score 0.6167 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Abca4 A C 3: 121,932,150 (GRCm39) Q268P probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Greb1 A T 12: 16,759,441 (GRCm39) V652E probably benign Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Or7g18 A G 9: 18,787,145 (GRCm39) D174G possibly damaging Het
Pcdhb18 A T 18: 37,623,533 (GRCm39) I288F probably damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc34a3 A G 2: 25,119,221 (GRCm39) S550P probably damaging Het
Slc4a1ap A G 5: 31,684,985 (GRCm39) H207R probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Ubqln5 T A 7: 103,778,696 (GRCm39) S43C probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19,650,360 (GRCm39) missense probably benign
IGL00945:Wwp1 APN 4 19,640,193 (GRCm39) critical splice donor site probably null
IGL01338:Wwp1 APN 4 19,627,636 (GRCm39) missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19,662,115 (GRCm39) splice site probably benign
IGL02969:Wwp1 APN 4 19,623,200 (GRCm39) missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19,678,408 (GRCm39) missense probably damaging 0.97
BB008:Wwp1 UTSW 4 19,650,114 (GRCm39) critical splice donor site probably null
BB018:Wwp1 UTSW 4 19,650,114 (GRCm39) critical splice donor site probably null
PIT4243001:Wwp1 UTSW 4 19,638,631 (GRCm39) missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19,631,116 (GRCm39) missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19,641,725 (GRCm39) intron probably benign
R0240:Wwp1 UTSW 4 19,641,734 (GRCm39) splice site probably null
R0240:Wwp1 UTSW 4 19,641,734 (GRCm39) splice site probably null
R0391:Wwp1 UTSW 4 19,627,911 (GRCm39) missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19,638,763 (GRCm39) intron probably benign
R1604:Wwp1 UTSW 4 19,659,709 (GRCm39) missense probably benign
R1716:Wwp1 UTSW 4 19,659,698 (GRCm39) missense probably benign 0.00
R1778:Wwp1 UTSW 4 19,627,892 (GRCm39) nonsense probably null
R1832:Wwp1 UTSW 4 19,650,197 (GRCm39) missense probably benign 0.33
R2073:Wwp1 UTSW 4 19,662,181 (GRCm39) missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19,650,390 (GRCm39) missense probably benign 0.00
R2228:Wwp1 UTSW 4 19,641,745 (GRCm39) missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19,641,745 (GRCm39) missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19,638,618 (GRCm39) missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19,662,032 (GRCm39) missense probably benign 0.07
R2349:Wwp1 UTSW 4 19,638,644 (GRCm39) missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19,631,085 (GRCm39) missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19,638,644 (GRCm39) missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19,661,990 (GRCm39) missense probably benign 0.00
R4732:Wwp1 UTSW 4 19,661,990 (GRCm39) missense probably benign 0.00
R4733:Wwp1 UTSW 4 19,661,990 (GRCm39) missense probably benign 0.00
R4838:Wwp1 UTSW 4 19,662,143 (GRCm39) missense probably benign 0.31
R4936:Wwp1 UTSW 4 19,638,804 (GRCm39) missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19,631,057 (GRCm39) missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19,638,773 (GRCm39) critical splice donor site probably null
R5847:Wwp1 UTSW 4 19,662,174 (GRCm39) missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19,650,299 (GRCm39) missense possibly damaging 0.94
R6628:Wwp1 UTSW 4 19,661,963 (GRCm39) splice site probably null
R7017:Wwp1 UTSW 4 19,623,124 (GRCm39) missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19,627,908 (GRCm39) missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19,611,782 (GRCm39) missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19,640,016 (GRCm39) missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19,627,660 (GRCm39) missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19,662,188 (GRCm39) missense probably benign 0.00
R7707:Wwp1 UTSW 4 19,627,645 (GRCm39) missense probably benign 0.31
R7812:Wwp1 UTSW 4 19,639,991 (GRCm39) missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19,635,328 (GRCm39) missense probably damaging 1.00
R7931:Wwp1 UTSW 4 19,650,114 (GRCm39) critical splice donor site probably null
R8006:Wwp1 UTSW 4 19,650,174 (GRCm39) missense probably benign
R8851:Wwp1 UTSW 4 19,643,437 (GRCm39) missense probably null 1.00
R8910:Wwp1 UTSW 4 19,627,741 (GRCm39) missense possibly damaging 0.70
R9020:Wwp1 UTSW 4 19,650,282 (GRCm39) missense probably benign
R9417:Wwp1 UTSW 4 19,662,215 (GRCm39) missense possibly damaging 0.67
R9736:Wwp1 UTSW 4 19,631,202 (GRCm39) missense probably damaging 0.99
X0018:Wwp1 UTSW 4 19,640,261 (GRCm39) missense probably benign 0.41
X0062:Wwp1 UTSW 4 19,638,794 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACAGGACGAGATTCCAAGTCC -3'
(R):5'- TTCCATCCCTAGTAATGCCAGTAG -3'

Sequencing Primer
(F):5'- GGACGAGATTCCAAGTCCAAAATC -3'
(R):5'- CTATGCTTTAGTTGTCAGGAG -3'
Posted On 2018-06-22