Incidental Mutation 'R6602:4921539E11Rik'
ID525334
Institutional Source Beutler Lab
Gene Symbol 4921539E11Rik
Ensembl Gene ENSMUSG00000028520
Gene NameRIKEN cDNA 4921539E11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location103230445-103290863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103255572 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 12 (H12R)
Ref Sequence ENSEMBL: ENSMUSP00000131846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030245] [ENSMUST00000097944] [ENSMUST00000168664]
Predicted Effect probably benign
Transcript: ENSMUST00000030245
AA Change: H113R

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030245
Gene: ENSMUSG00000028520
AA Change: H113R

DomainStartEndE-ValueType
Pfam:DUF4545 1 443 6.1e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097944
AA Change: H113R

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095557
Gene: ENSMUSG00000028520
AA Change: H113R

DomainStartEndE-ValueType
Pfam:DUF4545 1 270 7.3e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168664
AA Change: H12R

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131846
Gene: ENSMUSG00000028520
AA Change: H12R

DomainStartEndE-ValueType
Pfam:DUF4545 1 342 4.4e-183 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in 4921539E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:4921539E11Rik APN 4 103235786 missense possibly damaging 0.95
IGL00864:4921539E11Rik APN 4 103235698 missense probably damaging 1.00
IGL01951:4921539E11Rik APN 4 103235668 missense probably damaging 1.00
IGL02477:4921539E11Rik APN 4 103270746 missense probably benign 0.04
IGL02606:4921539E11Rik APN 4 103242781 missense probably benign 0.01
IGL03210:4921539E11Rik APN 4 103284438 missense probably benign 0.01
R0441:4921539E11Rik UTSW 4 103235492 intron probably benign
R0455:4921539E11Rik UTSW 4 103230983 missense possibly damaging 0.69
R0504:4921539E11Rik UTSW 4 103270860 splice site probably benign
R0636:4921539E11Rik UTSW 4 103231217 missense probably damaging 1.00
R0766:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R0799:4921539E11Rik UTSW 4 103242904 missense possibly damaging 0.83
R1312:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R1713:4921539E11Rik UTSW 4 103270767 missense possibly damaging 0.92
R1783:4921539E11Rik UTSW 4 103231089 missense probably damaging 0.99
R1978:4921539E11Rik UTSW 4 103270764 missense possibly damaging 0.49
R3735:4921539E11Rik UTSW 4 103266406 missense probably damaging 1.00
R4821:4921539E11Rik UTSW 4 103235674 missense probably damaging 1.00
R5274:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5275:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5431:4921539E11Rik UTSW 4 103270848 missense probably benign 0.00
R5449:4921539E11Rik UTSW 4 103266382 missense probably benign
R6049:4921539E11Rik UTSW 4 103231323 missense probably benign 0.05
R6277:4921539E11Rik UTSW 4 103231471 nonsense probably null
R6518:4921539E11Rik UTSW 4 103266411 missense probably damaging 1.00
R6634:4921539E11Rik UTSW 4 103236930 critical splice donor site probably null
R6992:4921539E11Rik UTSW 4 103242793 missense possibly damaging 0.57
R7575:4921539E11Rik UTSW 4 103230995 missense probably damaging 1.00
R8130:4921539E11Rik UTSW 4 103235698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTCCACAGCTTTATCTTACGC -3'
(R):5'- CAAGGGAGTCGTTTTGGAATAG -3'

Sequencing Primer
(F):5'- CAGATGAAATTGCTTGACATCCTCAC -3'
(R):5'- AGTCGTTTTGGAATAGATTTCTCTC -3'
Posted On2018-06-22