Incidental Mutation 'R6602:Cyp4a31'
ID525336
Institutional Source Beutler Lab
Gene Symbol Cyp4a31
Ensembl Gene ENSMUSG00000028712
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 31
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115563649-115579015 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 115569707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030480] [ENSMUST00000030486] [ENSMUST00000126645] [ENSMUST00000141033]
Predicted Effect probably null
Transcript: ENSMUST00000030480
SMART Domains Protein: ENSMUSP00000030480
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 415 3.6e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000030486
SMART Domains Protein: ENSMUSP00000030486
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 504 2.6e-134 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126645
SMART Domains Protein: ENSMUSP00000117129
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 340 4.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141033
SMART Domains Protein: ENSMUSP00000115628
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 155 2.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Cyp4a31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cyp4a31 APN 4 115574974 unclassified probably benign
IGL01682:Cyp4a31 APN 4 115578031 missense probably damaging 0.97
IGL02112:Cyp4a31 APN 4 115570983 missense probably damaging 1.00
IGL02292:Cyp4a31 APN 4 115566501 missense probably damaging 0.98
IGL02343:Cyp4a31 APN 4 115563829 missense probably damaging 1.00
IGL02508:Cyp4a31 APN 4 115571064 missense probably damaging 1.00
IGL03094:Cyp4a31 APN 4 115578108 utr 3 prime probably benign
IGL03493:Cyp4a31 APN 4 115570755 splice site probably null
R0400:Cyp4a31 UTSW 4 115563718 start codon destroyed probably null 1.00
R1263:Cyp4a31 UTSW 4 115574711 missense probably benign 0.01
R1508:Cyp4a31 UTSW 4 115565053 missense possibly damaging 0.53
R1523:Cyp4a31 UTSW 4 115569754 missense probably benign 0.23
R1822:Cyp4a31 UTSW 4 115566613 splice site probably null
R1832:Cyp4a31 UTSW 4 115569731 missense probably benign
R1872:Cyp4a31 UTSW 4 115574736 missense probably damaging 0.99
R2351:Cyp4a31 UTSW 4 115571313 missense possibly damaging 0.95
R2426:Cyp4a31 UTSW 4 115571016 missense probably damaging 0.98
R2993:Cyp4a31 UTSW 4 115569820 missense probably benign 0.03
R3743:Cyp4a31 UTSW 4 115566519 missense possibly damaging 0.95
R3812:Cyp4a31 UTSW 4 115566509 missense probably benign
R3963:Cyp4a31 UTSW 4 115574772 unclassified probably benign
R4211:Cyp4a31 UTSW 4 115565013 missense probably benign 0.01
R4814:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6245:Cyp4a31 UTSW 4 115571348 missense possibly damaging 0.91
R6255:Cyp4a31 UTSW 4 115574920 missense possibly damaging 0.82
R6330:Cyp4a31 UTSW 4 115563877 missense probably damaging 0.99
R6433:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6844:Cyp4a31 UTSW 4 115563792 missense probably null 0.00
R7154:Cyp4a31 UTSW 4 115574766 critical splice donor site probably null
R7300:Cyp4a31 UTSW 4 115570271 missense probably benign 0.03
R8188:Cyp4a31 UTSW 4 115569746 missense probably benign 0.29
X0020:Cyp4a31 UTSW 4 115565109 missense probably benign 0.06
X0021:Cyp4a31 UTSW 4 115577961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCTCAGCTTCCCATAC -3'
(R):5'- TTGGTAAGACAAAGGCCGTG -3'

Sequencing Primer
(F):5'- TGAGCTCAGCTTCCCATACACTAATG -3'
(R):5'- GTGAAGTTCAAGGCTTGTCACTCAC -3'
Posted On2018-06-22