Incidental Mutation 'R6602:Slc4a1ap'
ID 525340
Institutional Source Beutler Lab
Gene Symbol Slc4a1ap
Ensembl Gene ENSMUSG00000029141
Gene Name solute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonyms kanadaptin
Accession Numbers
Essential gene? Probably essential (E-score: 0.755) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 31684339-31714276 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31684985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 207 (H207R)
Ref Sequence ENSEMBL: ENSMUSP00000144613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065388] [ENSMUST00000114533] [ENSMUST00000200721] [ENSMUST00000201769] [ENSMUST00000201858] [ENSMUST00000202214] [ENSMUST00000202950] [ENSMUST00000202421]
AlphaFold E9PX68
Predicted Effect probably benign
Transcript: ENSMUST00000065388
SMART Domains Protein: ENSMUSP00000067337
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
low complexity region 378 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114533
AA Change: H207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110179
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200721
SMART Domains Protein: ENSMUSP00000144294
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 46 68 N/A INTRINSIC
BTP 100 179 5.13e-25 SMART
low complexity region 329 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201692
Predicted Effect probably benign
Transcript: ENSMUST00000201769
SMART Domains Protein: ENSMUSP00000144065
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
low complexity region 378 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201858
AA Change: H207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143960
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 2e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202214
AA Change: H207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202950
AA Change: H207R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202016
Predicted Effect probably benign
Transcript: ENSMUST00000202421
SMART Domains Protein: ENSMUSP00000143795
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
Meta Mutation Damage Score 0.9110 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Abca4 A C 3: 121,932,150 (GRCm39) Q268P probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Greb1 A T 12: 16,759,441 (GRCm39) V652E probably benign Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Or7g18 A G 9: 18,787,145 (GRCm39) D174G possibly damaging Het
Pcdhb18 A T 18: 37,623,533 (GRCm39) I288F probably damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc34a3 A G 2: 25,119,221 (GRCm39) S550P probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Ubqln5 T A 7: 103,778,696 (GRCm39) S43C probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,816 (GRCm39) V413D probably damaging Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Slc4a1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Slc4a1ap APN 5 31,711,121 (GRCm39) missense probably damaging 1.00
IGL01526:Slc4a1ap APN 5 31,685,571 (GRCm39) missense possibly damaging 0.86
R1556:Slc4a1ap UTSW 5 31,691,554 (GRCm39) splice site probably null
R1694:Slc4a1ap UTSW 5 31,701,098 (GRCm39) missense probably damaging 1.00
R1884:Slc4a1ap UTSW 5 31,691,524 (GRCm39) missense probably damaging 1.00
R3787:Slc4a1ap UTSW 5 31,685,483 (GRCm39) missense possibly damaging 0.92
R4510:Slc4a1ap UTSW 5 31,684,747 (GRCm39) missense probably benign 0.00
R4511:Slc4a1ap UTSW 5 31,684,747 (GRCm39) missense probably benign 0.00
R4562:Slc4a1ap UTSW 5 31,689,373 (GRCm39) missense probably damaging 1.00
R4828:Slc4a1ap UTSW 5 31,688,053 (GRCm39) nonsense probably null
R5611:Slc4a1ap UTSW 5 31,711,173 (GRCm39) utr 3 prime probably benign
R5648:Slc4a1ap UTSW 5 31,708,129 (GRCm39) splice site probably null
R5991:Slc4a1ap UTSW 5 31,691,413 (GRCm39) missense possibly damaging 0.92
R6531:Slc4a1ap UTSW 5 31,705,982 (GRCm39) missense probably benign 0.18
R6770:Slc4a1ap UTSW 5 31,685,226 (GRCm39) splice site probably null
R6844:Slc4a1ap UTSW 5 31,684,822 (GRCm39) missense probably damaging 1.00
R7103:Slc4a1ap UTSW 5 31,701,201 (GRCm39) missense probably benign
R7342:Slc4a1ap UTSW 5 31,693,634 (GRCm39) missense possibly damaging 0.89
R7378:Slc4a1ap UTSW 5 31,684,871 (GRCm39) missense probably benign
R7527:Slc4a1ap UTSW 5 31,691,475 (GRCm39) missense probably benign 0.04
R7603:Slc4a1ap UTSW 5 31,703,539 (GRCm39) missense
R7608:Slc4a1ap UTSW 5 31,693,533 (GRCm39) missense possibly damaging 0.51
R7781:Slc4a1ap UTSW 5 31,684,822 (GRCm39) missense probably damaging 1.00
R8867:Slc4a1ap UTSW 5 31,708,059 (GRCm39) missense probably benign
R9083:Slc4a1ap UTSW 5 31,684,457 (GRCm39) missense probably benign 0.00
R9109:Slc4a1ap UTSW 5 31,693,538 (GRCm39) missense probably damaging 1.00
R9161:Slc4a1ap UTSW 5 31,685,474 (GRCm39) missense
R9298:Slc4a1ap UTSW 5 31,693,538 (GRCm39) missense probably damaging 1.00
R9460:Slc4a1ap UTSW 5 31,685,463 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGTCTGGAGCATCCTTCCG -3'
(R):5'- CAGAATGAGGCCTGTGCTTTTG -3'

Sequencing Primer
(F):5'- GTGTCTCGGTACCATGCTGTAC -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On 2018-06-22