Incidental Mutation 'R6602:Slc4a1ap'
ID525340
Institutional Source Beutler Lab
Gene Symbol Slc4a1ap
Ensembl Gene ENSMUSG00000029141
Gene Namesolute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonymskanadaptin
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31526995-31556932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31527641 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 207 (H207R)
Ref Sequence ENSEMBL: ENSMUSP00000144613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065388] [ENSMUST00000114533] [ENSMUST00000200721] [ENSMUST00000201769] [ENSMUST00000201858] [ENSMUST00000202214] [ENSMUST00000202421] [ENSMUST00000202950]
Predicted Effect probably benign
Transcript: ENSMUST00000065388
SMART Domains Protein: ENSMUSP00000067337
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
low complexity region 378 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114533
AA Change: H207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110179
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200721
SMART Domains Protein: ENSMUSP00000144294
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 46 68 N/A INTRINSIC
BTP 100 179 5.13e-25 SMART
low complexity region 329 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201692
Predicted Effect probably benign
Transcript: ENSMUST00000201769
SMART Domains Protein: ENSMUSP00000144065
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
low complexity region 378 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201858
AA Change: H207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143960
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 2e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202016
Predicted Effect probably damaging
Transcript: ENSMUST00000202214
AA Change: H207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202421
SMART Domains Protein: ENSMUSP00000143795
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202932
Predicted Effect probably damaging
Transcript: ENSMUST00000202950
AA Change: H207R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141
AA Change: H207R

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Meta Mutation Damage Score 0.9110 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Slc4a1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Slc4a1ap APN 5 31553777 missense probably damaging 1.00
IGL01526:Slc4a1ap APN 5 31528227 missense possibly damaging 0.86
R1556:Slc4a1ap UTSW 5 31534210 splice site probably null
R1694:Slc4a1ap UTSW 5 31543754 missense probably damaging 1.00
R1884:Slc4a1ap UTSW 5 31534180 missense probably damaging 1.00
R3787:Slc4a1ap UTSW 5 31528139 missense possibly damaging 0.92
R4510:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4511:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4562:Slc4a1ap UTSW 5 31532029 missense probably damaging 1.00
R4828:Slc4a1ap UTSW 5 31530709 nonsense probably null
R5611:Slc4a1ap UTSW 5 31553829 utr 3 prime probably benign
R5648:Slc4a1ap UTSW 5 31550785 splice site probably null
R5991:Slc4a1ap UTSW 5 31534069 missense possibly damaging 0.92
R6531:Slc4a1ap UTSW 5 31548638 missense probably benign 0.18
R6770:Slc4a1ap UTSW 5 31527882 intron probably null
R6844:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
R7103:Slc4a1ap UTSW 5 31543857 missense probably benign
R7342:Slc4a1ap UTSW 5 31536290 missense possibly damaging 0.89
R7378:Slc4a1ap UTSW 5 31527527 missense probably benign
R7527:Slc4a1ap UTSW 5 31534131 missense probably benign 0.04
R7603:Slc4a1ap UTSW 5 31546195 missense
R7608:Slc4a1ap UTSW 5 31536189 missense possibly damaging 0.51
R7781:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTCTGGAGCATCCTTCCG -3'
(R):5'- CAGAATGAGGCCTGTGCTTTTG -3'

Sequencing Primer
(F):5'- GTGTCTCGGTACCATGCTGTAC -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2018-06-22