Incidental Mutation 'R6602:Klk11'
ID525346
Institutional Source Beutler Lab
Gene Symbol Klk11
Ensembl Gene ENSMUSG00000067616
Gene Namekallikrein related-peptidase 11
Synonymshippostasin, Prss20, TLSP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43774604-43779263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43774774 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 6 (S6G)
Ref Sequence ENSEMBL: ENSMUSP00000079101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014063] [ENSMUST00000080211] [ENSMUST00000107970] [ENSMUST00000171458]
Predicted Effect probably benign
Transcript: ENSMUST00000014063
SMART Domains Protein: ENSMUSP00000014063
Gene: ENSMUSG00000044430

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 21 240 1.3e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080211
AA Change: S6G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079101
Gene: ENSMUSG00000067616
AA Change: S6G

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Tryp_SPc 47 269 5.14e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107970
SMART Domains Protein: ENSMUSP00000103604
Gene: ENSMUSG00000044430

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 21 240 1.3e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171458
SMART Domains Protein: ENSMUSP00000132721
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 242 5.14e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206165
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Klk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Klk11 APN 7 43778413 missense probably damaging 0.97
IGL03090:Klk11 APN 7 43777553 missense probably benign 0.00
aceto UTSW 7 43774774 missense probably benign 0.18
sotto UTSW 7 43778912 missense probably damaging 0.99
R0326:Klk11 UTSW 7 43776519 start codon destroyed probably null 0.01
R1370:Klk11 UTSW 7 43776907 missense probably benign 0.03
R1503:Klk11 UTSW 7 43778909 nonsense probably null
R1812:Klk11 UTSW 7 43777755 critical splice donor site probably null
R3003:Klk11 UTSW 7 43776995 missense probably damaging 0.99
R4974:Klk11 UTSW 7 43777736 missense probably damaging 0.98
R5654:Klk11 UTSW 7 43778386 missense probably damaging 1.00
R5730:Klk11 UTSW 7 43774775 missense probably benign 0.33
R6834:Klk11 UTSW 7 43778912 missense probably damaging 0.99
R7310:Klk11 UTSW 7 43778830 missense probably damaging 0.99
R7741:Klk11 UTSW 7 43776997 missense probably benign 0.03
R8185:Klk11 UTSW 7 43776908 missense probably damaging 1.00
Z1177:Klk11 UTSW 7 43778335 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GATGGTAGCCTTTTCCAACATC -3'
(R):5'- AATCTGGGGCGTCATAGAGG -3'

Sequencing Primer
(F):5'- TAGAGAACTGAGCTTCCCTGG -3'
(R):5'- CGTCATAGAGGTGGGGCTGC -3'
Posted On2018-06-22