Incidental Mutation 'R6633:Dgcr8'
ID525347
Institutional Source Beutler Lab
Gene Symbol Dgcr8
Ensembl Gene ENSMUSG00000022718
Gene NameDGCR8, microprocessor complex subunit
SynonymsGy1, D16H22S788E, D16Wis2, D16H22S1742E, Vo59c07, N41
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18253948-18289246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18284182 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 79 (S79T)
Ref Sequence ENSEMBL: ENSMUSP00000155858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000115633] [ENSMUST00000232424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009321
AA Change: S79T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718
AA Change: S79T

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115633
SMART Domains Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232414
Predicted Effect possibly damaging
Transcript: ENSMUST00000232424
AA Change: S79T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the microprocessor complex which mediates the biogenesis of microRNAs from the primary microRNA transcript. The encoded protein is a double-stranded RNA binding protein that functions as the non-catalytic subunit of the microprocessor complex. This protein is required for binding the double-stranded RNA substrate and facilitates cleavage of the RNA by the ribonuclease III protein, Drosha. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit reduced dendritic spine number and dendritiic complexity along with abnormal prepulse inhibition and abnormal spatial working memory. Homozygous mice are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Dgcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Dgcr8 APN 16 18283944 missense probably damaging 1.00
IGL01767:Dgcr8 APN 16 18278336 missense probably damaging 0.98
IGL02349:Dgcr8 APN 16 18280306 missense possibly damaging 0.67
IGL02834:Dgcr8 APN 16 18272759 missense probably benign 0.08
disneyland UTSW 16 18259623 missense probably damaging 1.00
R1558:Dgcr8 UTSW 16 18259588 missense probably damaging 1.00
R1587:Dgcr8 UTSW 16 18280291 missense probably damaging 1.00
R1656:Dgcr8 UTSW 16 18256713 missense probably benign 0.00
R1866:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R1886:Dgcr8 UTSW 16 18278354 missense possibly damaging 0.95
R2144:Dgcr8 UTSW 16 18284256 missense probably damaging 1.00
R2145:Dgcr8 UTSW 16 18280230 missense probably benign 0.26
R3773:Dgcr8 UTSW 16 18256775 missense probably damaging 0.99
R4568:Dgcr8 UTSW 16 18280394 missense probably benign 0.14
R4783:Dgcr8 UTSW 16 18258310 nonsense probably null
R4784:Dgcr8 UTSW 16 18258310 nonsense probably null
R5138:Dgcr8 UTSW 16 18278077 missense probably damaging 0.99
R5276:Dgcr8 UTSW 16 18283771 missense probably benign 0.01
R5476:Dgcr8 UTSW 16 18259979 missense probably damaging 1.00
R5510:Dgcr8 UTSW 16 18277175 missense probably damaging 0.98
R5745:Dgcr8 UTSW 16 18280443 missense probably benign 0.01
R5771:Dgcr8 UTSW 16 18272768 missense probably benign 0.25
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6182:Dgcr8 UTSW 16 18280308 missense probably benign 0.00
R6190:Dgcr8 UTSW 16 18284410 missense probably damaging 0.97
R6786:Dgcr8 UTSW 16 18283829 nonsense probably null
R7468:Dgcr8 UTSW 16 18259623 missense probably damaging 1.00
Z1176:Dgcr8 UTSW 16 18278318 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGTACAGCACCTTCCTGTC -3'
(R):5'- TGGAGACATATGAGAGTCCCTC -3'

Sequencing Primer
(F):5'- CCTTACTCCTGCAGCTCTCAGTAAAG -3'
(R):5'- CGATGATGGAGAACCGAGCTTG -3'
Posted On2018-06-22