Incidental Mutation 'R6602:Il18bp'

• ID: 525351
• Institutional Source: Beutler Lab
• Gene Symbol: Il18bp
• Ensembl Gene: ENSMUSG00000070427
• Gene Name: interleukin 18 binding protein
• Synonyms: Igifbp, MC54L, IL-18BP
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R6602 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 7
• Chromosomal Location: 102014885-102018690 bp(-) (GRCm38)
• Type of Mutation: unclassified
• DNA Base Change (assembly): T to C at 102016030 bp (GRCm38)
• Zygosity: Heterozygous
• Ref Sequence: ENSEMBL: ENSMUSP00000147912
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000089052] [ENSMUST00000094134] [ENSMUST00000096639] [ENSMUST00000106953] [ENSMUST00000163183] [ENSMUST00000209368] [ENSMUST00000209844] [ENSMUST00000211502]
• AlphaFold: Q9Z0M9
• Predicted Effect: probably benign; Transcript: ENSMUST00000084852
• SMART Domains: Protein: ENSMUSP00000081912; Gene: ENSMUSG00000066306

Domain	Start	End	E-Value	Type
low complexity region	187	201	N/A	INTRINSIC
coiled coil region	211	249	N/A	INTRINSIC
coiled coil region	274	818	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
internal_repeat_1	910	933	6.03e-6	PROSPERO
internal_repeat_2	911	951	2.35e-5	PROSPERO
low complexity region	979	992	N/A	INTRINSIC
low complexity region	1002	1018	N/A	INTRINSIC
low complexity region	1063	1081	N/A	INTRINSIC
internal_repeat_5	1094	1116	4.63e-5	PROSPERO
low complexity region	1130	1138	N/A	INTRINSIC
low complexity region	1220	1233	N/A	INTRINSIC
low complexity region	1271	1289	N/A	INTRINSIC
low complexity region	1364	1374	N/A	INTRINSIC
coiled coil region	1464	1681	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
internal_repeat_3	1718	1755	4.63e-5	PROSPERO
internal_repeat_4	1777	1819	4.63e-5	PROSPERO
internal_repeat_3	1800	1842	4.63e-5	PROSPERO
internal_repeat_4	1811	1854	4.63e-5	PROSPERO
low complexity region	1859	1875	N/A	INTRINSIC
PDB:3RO2|B	1881	1908	3e-13	PDB
internal_repeat_2	1938	1977	2.35e-5	PROSPERO
internal_repeat_5	1973	1995	4.63e-5	PROSPERO
internal_repeat_1	2020	2043	6.03e-6	PROSPERO
low complexity region	2073	2085	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000089052
• SMART Domains: Protein: ENSMUSP00000086453; Gene: ENSMUSG00000070426

Domain	Start	End	E-Value	Type
transmembrane domain	27	49	N/A	INTRINSIC
transmembrane domain	56	73	N/A	INTRINSIC
transmembrane domain	78	97	N/A	INTRINSIC
transmembrane domain	117	139	N/A	INTRINSIC
transmembrane domain	152	169	N/A	INTRINSIC
RING	203	252	9.83e-4	SMART
transmembrane domain	279	301	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000094134
• SMART Domains: Protein: ENSMUSP00000091685; Gene: ENSMUSG00000070427

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Blast:IG	66	170	7e-54	BLAST
PDB:4EKX|A	71	167	6e-6	PDB

• Predicted Effect: probably benign; Transcript: ENSMUST00000096639
• SMART Domains: Protein: ENSMUSP00000094396; Gene: ENSMUSG00000070426

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
transmembrane domain	50	72	N/A	INTRINSIC
transmembrane domain	79	96	N/A	INTRINSIC
transmembrane domain	101	120	N/A	INTRINSIC
transmembrane domain	140	162	N/A	INTRINSIC
transmembrane domain	175	192	N/A	INTRINSIC
RING	226	275	9.83e-4	SMART
transmembrane domain	302	324	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000106953
• SMART Domains: Protein: ENSMUSP00000102566; Gene: ENSMUSG00000070426

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
transmembrane domain	62	79	N/A	INTRINSIC
transmembrane domain	84	103	N/A	INTRINSIC
transmembrane domain	123	145	N/A	INTRINSIC
transmembrane domain	158	175	N/A	INTRINSIC
RING	209	258	9.83e-4	SMART
transmembrane domain	285	307	N/A	INTRINSIC

• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000149976
• Predicted Effect: probably benign; Transcript: ENSMUST00000163183
• SMART Domains: Protein: ENSMUSP00000126180; Gene: ENSMUSG00000066306

Domain	Start	End	E-Value	Type
coiled coil region	7	73	N/A	INTRINSIC
low complexity region	150	160	N/A	INTRINSIC
SCOP:d1fxkc_	164	290	7e-3	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	506	522	N/A	INTRINSIC
PDB:3RO2|B	528	555	2e-10	PDB
low complexity region	720	732	N/A	INTRINSIC

• Predicted Effect: unknown; Transcript: ENSMUST00000209368; AA Change: K169E
• Predicted Effect: probably benign; Transcript: ENSMUST00000209844
• Predicted Effect: probably benign; Transcript: ENSMUST00000211502
• Coding Region Coverage:
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
• Validation Efficiency: 100% (43/43)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011] ; PHENOTYPE: Homozygous knockout affects NK cell differentiation and function, with an increase in immature cells and a decrease in mature cells. [provided by MGI curators]
• Posted On: 2018-06-22

Predicted Primers

PCR Primer
(F):5'- TGTCTTCAACCCATCCTGGAG -3'
(R):5'- GGCAACCCTCTCACGATTTC -3'

Sequencing Primer
(F):5'- TGCACACATGGTCAGAGC -3'
(R):5'- ACGATTTCCTTCTGCTTTCCAG -3'