Incidental Mutation 'R6602:Il18bp'
ID525351
Institutional Source Beutler Lab
Gene Symbol Il18bp
Ensembl Gene ENSMUSG00000070427
Gene Nameinterleukin 18 binding protein
SynonymsIgifbp, MC54L, IL-18BP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102014885-102018690 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 102016030 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000089052] [ENSMUST00000094134] [ENSMUST00000096639] [ENSMUST00000106953] [ENSMUST00000163183] [ENSMUST00000209368] [ENSMUST00000209844] [ENSMUST00000211502]
Predicted Effect probably benign
Transcript: ENSMUST00000084852
SMART Domains Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306

DomainStartEndE-ValueType
low complexity region 187 201 N/A INTRINSIC
coiled coil region 211 249 N/A INTRINSIC
coiled coil region 274 818 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
internal_repeat_1 910 933 6.03e-6 PROSPERO
internal_repeat_2 911 951 2.35e-5 PROSPERO
low complexity region 979 992 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1063 1081 N/A INTRINSIC
internal_repeat_5 1094 1116 4.63e-5 PROSPERO
low complexity region 1130 1138 N/A INTRINSIC
low complexity region 1220 1233 N/A INTRINSIC
low complexity region 1271 1289 N/A INTRINSIC
low complexity region 1364 1374 N/A INTRINSIC
coiled coil region 1464 1681 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
internal_repeat_3 1718 1755 4.63e-5 PROSPERO
internal_repeat_4 1777 1819 4.63e-5 PROSPERO
internal_repeat_3 1800 1842 4.63e-5 PROSPERO
internal_repeat_4 1811 1854 4.63e-5 PROSPERO
low complexity region 1859 1875 N/A INTRINSIC
PDB:3RO2|B 1881 1908 3e-13 PDB
internal_repeat_2 1938 1977 2.35e-5 PROSPERO
internal_repeat_5 1973 1995 4.63e-5 PROSPERO
internal_repeat_1 2020 2043 6.03e-6 PROSPERO
low complexity region 2073 2085 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089052
SMART Domains Protein: ENSMUSP00000086453
Gene: ENSMUSG00000070426

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 56 73 N/A INTRINSIC
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 152 169 N/A INTRINSIC
RING 203 252 9.83e-4 SMART
transmembrane domain 279 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094134
SMART Domains Protein: ENSMUSP00000091685
Gene: ENSMUSG00000070427

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:IG 66 170 7e-54 BLAST
PDB:4EKX|A 71 167 6e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000096639
SMART Domains Protein: ENSMUSP00000094396
Gene: ENSMUSG00000070426

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 79 96 N/A INTRINSIC
transmembrane domain 101 120 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 175 192 N/A INTRINSIC
RING 226 275 9.83e-4 SMART
transmembrane domain 302 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106953
SMART Domains Protein: ENSMUSP00000102566
Gene: ENSMUSG00000070426

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 62 79 N/A INTRINSIC
transmembrane domain 84 103 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 158 175 N/A INTRINSIC
RING 209 258 9.83e-4 SMART
transmembrane domain 285 307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149976
Predicted Effect probably benign
Transcript: ENSMUST00000163183
SMART Domains Protein: ENSMUSP00000126180
Gene: ENSMUSG00000066306

DomainStartEndE-ValueType
coiled coil region 7 73 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
SCOP:d1fxkc_ 164 290 7e-3 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 506 522 N/A INTRINSIC
PDB:3RO2|B 528 555 2e-10 PDB
low complexity region 720 732 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209368
AA Change: K169E
Predicted Effect probably benign
Transcript: ENSMUST00000209844
Predicted Effect probably benign
Transcript: ENSMUST00000211502
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous knockout affects NK cell differentiation and function, with an increase in immature cells and a decrease in mature cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Il18bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Il18bp APN 7 102016795 missense possibly damaging 0.92
R6870:Il18bp UTSW 7 102017311 missense possibly damaging 0.66
R7872:Il18bp UTSW 7 102016795 missense possibly damaging 0.92
R7955:Il18bp UTSW 7 102016795 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCTTCAACCCATCCTGGAG -3'
(R):5'- GGCAACCCTCTCACGATTTC -3'

Sequencing Primer
(F):5'- TGCACACATGGTCAGAGC -3'
(R):5'- ACGATTTCCTTCTGCTTTCCAG -3'
Posted On2018-06-22