Incidental Mutation 'R6602:Ubqln5'
ID 525354
Institutional Source Beutler Lab
Gene Symbol Ubqln5
Ensembl Gene ENSMUSG00000055643
Gene Name ubiquilin 5
Synonyms 4931431F19Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103777120-103779030 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103778696 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 43 (S43C)
Ref Sequence ENSEMBL: ENSMUSP00000062054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053743] [ENSMUST00000138055]
AlphaFold Q9D4I8
PDB Structure Solution Structure of RSGI RUH-016, a UBA Domain from mouse cDNA [SOLUTION NMR]
Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000053743
AA Change: S43C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062054
Gene: ENSMUSG00000055643
AA Change: S43C

DomainStartEndE-ValueType
UBQ 24 94 7.97e-13 SMART
low complexity region 365 376 N/A INTRINSIC
UBA 468 506 2.14e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Abca4 A C 3: 121,932,150 (GRCm39) Q268P probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Greb1 A T 12: 16,759,441 (GRCm39) V652E probably benign Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Or7g18 A G 9: 18,787,145 (GRCm39) D174G possibly damaging Het
Pcdhb18 A T 18: 37,623,533 (GRCm39) I288F probably damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc34a3 A G 2: 25,119,221 (GRCm39) S550P probably damaging Het
Slc4a1ap A G 5: 31,684,985 (GRCm39) H207R probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,816 (GRCm39) V413D probably damaging Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Ubqln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Ubqln5 APN 7 103,777,634 (GRCm39) missense possibly damaging 0.83
IGL02127:Ubqln5 APN 7 103,778,689 (GRCm39) missense probably damaging 0.99
IGL02565:Ubqln5 APN 7 103,778,279 (GRCm39) nonsense probably null
R1181:Ubqln5 UTSW 7 103,777,948 (GRCm39) missense probably damaging 0.99
R1962:Ubqln5 UTSW 7 103,778,134 (GRCm39) missense probably damaging 0.98
R1962:Ubqln5 UTSW 7 103,778,095 (GRCm39) missense possibly damaging 0.83
R1964:Ubqln5 UTSW 7 103,778,095 (GRCm39) missense possibly damaging 0.83
R1992:Ubqln5 UTSW 7 103,778,741 (GRCm39) missense probably damaging 1.00
R1998:Ubqln5 UTSW 7 103,777,948 (GRCm39) missense probably damaging 0.99
R3927:Ubqln5 UTSW 7 103,777,678 (GRCm39) missense probably damaging 1.00
R4831:Ubqln5 UTSW 7 103,778,829 (GRCm39) intron probably benign
R5699:Ubqln5 UTSW 7 103,778,632 (GRCm39) missense possibly damaging 0.78
R5840:Ubqln5 UTSW 7 103,778,161 (GRCm39) missense possibly damaging 0.83
R5858:Ubqln5 UTSW 7 103,778,018 (GRCm39) missense probably benign 0.17
R5907:Ubqln5 UTSW 7 103,777,781 (GRCm39) missense possibly damaging 0.55
R6477:Ubqln5 UTSW 7 103,777,465 (GRCm39) missense probably damaging 0.97
R6919:Ubqln5 UTSW 7 103,778,215 (GRCm39) missense probably benign 0.15
R6981:Ubqln5 UTSW 7 103,777,808 (GRCm39) missense probably benign 0.29
R8153:Ubqln5 UTSW 7 103,778,011 (GRCm39) missense possibly damaging 0.52
R8712:Ubqln5 UTSW 7 103,778,322 (GRCm39) missense probably benign 0.04
R8787:Ubqln5 UTSW 7 103,778,329 (GRCm39) missense probably benign 0.01
R9398:Ubqln5 UTSW 7 103,777,985 (GRCm39) missense probably benign 0.05
X0028:Ubqln5 UTSW 7 103,778,615 (GRCm39) missense probably damaging 1.00
Z1088:Ubqln5 UTSW 7 103,778,178 (GRCm39) missense possibly damaging 0.83
Z1176:Ubqln5 UTSW 7 103,778,125 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCCTACCAGAGTTCCTGTAC -3'
(R):5'- TCAGTGCCACATCAAAGCTTC -3'

Sequencing Primer
(F):5'- GTACAGGCTGACCCTTTCAAATGAG -3'
(R):5'- CATCAAAGCTTCTGCAGGTG -3'
Posted On 2018-06-22