Incidental Mutation 'R6602:Npy5r'
ID 525356
Institutional Source Beutler Lab
Gene Symbol Npy5r
Ensembl Gene ENSMUSG00000044014
Gene Name neuropeptide Y receptor Y5
Synonyms Y5R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R6602 (G1)
Quality Score 217.468
Status Validated
Chromosome 8
Chromosomal Location 66679965-66688128 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GCTGTGAAACACTG to GCTG at 66681540 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070810] [ENSMUST00000211920] [ENSMUST00000212563]
AlphaFold O70342
Predicted Effect probably null
Transcript: ENSMUST00000070810
AA Change: 196
SMART Domains Protein: ENSMUSP00000065157
Gene: ENSMUSG00000044014
AA Change: 196

DomainStartEndE-ValueType
internal_repeat_1 15 36 1.53e-7 PROSPERO
internal_repeat_1 36 57 1.53e-7 PROSPERO
Pfam:7TM_GPCR_Srsx 73 253 1.9e-10 PFAM
Pfam:7tm_1 79 445 2.9e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211920
Predicted Effect probably null
Transcript: ENSMUST00000212563
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for neuropeptide Y and peptide YY. The encoded protein appears to be involved in regulating food intake, with defects in this gene being associated with eating disorders. Also, the encoded protein is involved in a pathway that protects neuroblastoma cells from chemotherapy-induced cell death, providing a possible therapeutic target against neuroblastoma. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show increased susceptibility to diet-induced obesity and a reduced orexigenic response to select agonists. Homozygotes for a reporter allele show mild late-onset obesity, increased adiposity, polyphagia, and exacerbated obesity parameters after chronic NPY infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Npy5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Npy5r APN 8 66681866 missense possibly damaging 0.47
IGL02192:Npy5r APN 8 66681346 missense probably benign 0.02
oleo UTSW 8 66682041 nonsense probably null
roly-poly UTSW 8 66681540 frame shift probably null
R0395:Npy5r UTSW 8 66681973 missense probably benign 0.21
R1547:Npy5r UTSW 8 66681034 missense possibly damaging 0.52
R1616:Npy5r UTSW 8 66681400 missense probably damaging 1.00
R1906:Npy5r UTSW 8 66681473 missense probably damaging 1.00
R1965:Npy5r UTSW 8 66681277 missense probably benign
R2443:Npy5r UTSW 8 66681290 nonsense probably null
R4087:Npy5r UTSW 8 66682045 missense probably damaging 0.98
R4204:Npy5r UTSW 8 66682041 nonsense probably null
R4404:Npy5r UTSW 8 66681992 missense probably benign 0.01
R5427:Npy5r UTSW 8 66681020 missense probably damaging 0.98
R5530:Npy5r UTSW 8 66680860 missense probably benign 0.06
R5994:Npy5r UTSW 8 66682099 missense probably benign 0.06
R6041:Npy5r UTSW 8 66682023 missense possibly damaging 0.72
R6837:Npy5r UTSW 8 66681740 missense probably benign 0.00
R7879:Npy5r UTSW 8 66681316 missense possibly damaging 0.92
R7923:Npy5r UTSW 8 66681752 missense probably damaging 1.00
R8534:Npy5r UTSW 8 66682036 missense probably benign 0.00
R8699:Npy5r UTSW 8 66681622 missense probably damaging 1.00
R9094:Npy5r UTSW 8 66680908 missense probably damaging 1.00
R9338:Npy5r UTSW 8 66682006 missense probably benign 0.00
R9436:Npy5r UTSW 8 66680831 missense probably damaging 1.00
R9501:Npy5r UTSW 8 66681485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTATACTCCTGCAGACACTAG -3'
(R):5'- CAGTGGATGTTCGGCAAAGC -3'

Sequencing Primer
(F):5'- CCTGCAGACACTAGTATGACTTACTG -3'
(R):5'- AGCCATGTGCCATATCATGC -3'
Posted On 2018-06-22