Incidental Mutation 'R6602:Exoc8'
ID525360
Institutional Source Beutler Lab
Gene Symbol Exoc8
Ensembl Gene ENSMUSG00000074030
Gene Nameexocyst complex component 8
SynonymsSEC84, EXO84, Exo84p
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124893108-124897705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124896411 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 406 (V406L)
Ref Sequence ENSEMBL: ENSMUSP00000095915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034467] [ENSMUST00000098312]
Predicted Effect probably benign
Transcript: ENSMUST00000034467
SMART Domains Protein: ENSMUSP00000034467
Gene: ENSMUSG00000031986

DomainStartEndE-ValueType
SprT 44 213 4.39e-72 SMART
low complexity region 383 405 N/A INTRINSIC
low complexity region 442 462 N/A INTRINSIC
Blast:ZnF_Rad18 463 485 8e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098312
AA Change: V406L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095915
Gene: ENSMUSG00000074030
AA Change: V406L

DomainStartEndE-ValueType
Pfam:Vps51 13 99 7.1e-21 PFAM
PH 174 275 2.07e-6 SMART
low complexity region 279 294 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
Pfam:Exo84_C 326 531 6.8e-59 PFAM
low complexity region 633 646 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213052
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the exocyst complex, an evolutionarily conserved multi-protein complex that plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. This protein is a target of activated Ral subfamily of GTPases and thereby regulates exocytosis by tethering vesicles to the plasma membrane. Mutations in this gene may be related to Joubert syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Exoc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Exoc8 APN 8 124896872 missense probably damaging 1.00
IGL01444:Exoc8 APN 8 124895841 missense possibly damaging 0.84
IGL01655:Exoc8 APN 8 124896228 missense probably benign 0.03
IGL01881:Exoc8 APN 8 124896351 missense probably damaging 1.00
IGL02952:Exoc8 APN 8 124897536 missense probably benign 0.02
R0683:Exoc8 UTSW 8 124895633 missense probably damaging 0.99
R2051:Exoc8 UTSW 8 124895480 missense probably benign 0.15
R2140:Exoc8 UTSW 8 124897415 missense possibly damaging 0.84
R2197:Exoc8 UTSW 8 124895738 missense probably damaging 1.00
R2209:Exoc8 UTSW 8 124896179 nonsense probably null
R4659:Exoc8 UTSW 8 124897532 missense probably damaging 1.00
R4707:Exoc8 UTSW 8 124897470 missense possibly damaging 0.93
R4724:Exoc8 UTSW 8 124897250 missense probably benign
R4764:Exoc8 UTSW 8 124897575 missense possibly damaging 0.94
R5159:Exoc8 UTSW 8 124896213 missense probably benign 0.00
R5976:Exoc8 UTSW 8 124896653 missense probably benign 0.02
R6566:Exoc8 UTSW 8 124896044 missense probably damaging 1.00
R7246:Exoc8 UTSW 8 124896417 nonsense probably null
R7341:Exoc8 UTSW 8 124896581 missense probably damaging 1.00
R7440:Exoc8 UTSW 8 124895781 missense probably benign
R7745:Exoc8 UTSW 8 124895819 missense probably benign
Z1176:Exoc8 UTSW 8 124896666 missense possibly damaging 0.52
Z1177:Exoc8 UTSW 8 124897186 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AAGTCCGTCTCAAACTCTCTCG -3'
(R):5'- ATGTTTGTATTGCACAGAGGGAC -3'

Sequencing Primer
(F):5'- AACTCTCTCGCGGTCTCTAGGAG -3'
(R):5'- TATTGCACAGAGGGACTTTGAG -3'
Posted On2018-06-22