Incidental Mutation 'R6602:Olfr830'
ID 525361
Institutional Source Beutler Lab
Gene Symbol Olfr830
Ensembl Gene ENSMUSG00000062868
Gene Name olfactory receptor 830
Synonyms GA_x6K02T2PVTD-12618399-12619337, MOR152-1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18874693-18878369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18875849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000077903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
AlphaFold Q8VFJ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000078861
AA Change: D174G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: D174G

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212723
AA Change: D171G

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1734 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Olfr830
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Olfr830 APN 9 18876014 nonsense probably null
IGL00954:Olfr830 APN 9 18876073 missense probably benign 0.15
IGL01090:Olfr830 APN 9 18876242 missense probably benign 0.00
IGL01613:Olfr830 APN 9 18875321 splice site probably benign
IGL01987:Olfr830 APN 9 18875707 missense probably benign 0.00
IGL03018:Olfr830 APN 9 18876227 missense probably benign 0.15
IGL03037:Olfr830 APN 9 18875372 missense probably damaging 0.98
R0284:Olfr830 UTSW 9 18875552 missense probably benign
R1322:Olfr830 UTSW 9 18875521 missense possibly damaging 0.90
R1715:Olfr830 UTSW 9 18875794 missense probably benign 0.06
R1803:Olfr830 UTSW 9 18876080 missense probably damaging 1.00
R4360:Olfr830 UTSW 9 18875717 missense probably damaging 1.00
R4394:Olfr830 UTSW 9 18875611 missense probably damaging 0.98
R4642:Olfr830 UTSW 9 18876167 missense probably damaging 1.00
R4796:Olfr830 UTSW 9 18876179 missense probably damaging 0.96
R4814:Olfr830 UTSW 9 18875917 missense probably benign 0.30
R5210:Olfr830 UTSW 9 18875807 missense probably damaging 1.00
R5375:Olfr830 UTSW 9 18876146 missense probably benign 0.08
R6072:Olfr830 UTSW 9 18875422 missense probably benign
R6361:Olfr830 UTSW 9 18875731 missense probably damaging 1.00
R6920:Olfr830 UTSW 9 18875525 missense probably damaging 1.00
R7730:Olfr830 UTSW 9 18875413 missense probably benign 0.00
R7780:Olfr830 UTSW 9 18875614 missense possibly damaging 0.65
R8245:Olfr830 UTSW 9 18875830 missense probably benign
R8274:Olfr830 UTSW 9 18875499 missense probably benign 0.36
R8920:Olfr830 UTSW 9 18876098 missense probably damaging 1.00
R9564:Olfr830 UTSW 9 18875344 missense probably benign 0.00
X0026:Olfr830 UTSW 9 18875635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTTGGAGTAATGGCTTATGATC -3'
(R):5'- TGACAAATGAGACCCACAGG -3'

Sequencing Primer
(F):5'- ATGGCTTATGATCGCTACATAGCC -3'
(R):5'- ACAGGTGGAAAAGGCTTTGTACTTTC -3'
Posted On 2018-06-22