Incidental Mutation 'R6602:Or7g18'
ID 525361
Institutional Source Beutler Lab
Gene Symbol Or7g18
Ensembl Gene ENSMUSG00000062868
Gene Name olfactory receptor family 7 subfamily G member 18
Synonyms GA_x6K02T2PVTD-12618399-12619337, Olfr830, MOR152-1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18786256-18787572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18787145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000077903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
AlphaFold Q8VFJ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000078861
AA Change: D174G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: D174G

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212723
AA Change: D171G

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1734 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Abca4 A C 3: 121,932,150 (GRCm39) Q268P probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Greb1 A T 12: 16,759,441 (GRCm39) V652E probably benign Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Pcdhb18 A T 18: 37,623,533 (GRCm39) I288F probably damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc34a3 A G 2: 25,119,221 (GRCm39) S550P probably damaging Het
Slc4a1ap A G 5: 31,684,985 (GRCm39) H207R probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Ubqln5 T A 7: 103,778,696 (GRCm39) S43C probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,816 (GRCm39) V413D probably damaging Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Or7g18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Or7g18 APN 9 18,787,310 (GRCm39) nonsense probably null
IGL00954:Or7g18 APN 9 18,787,369 (GRCm39) missense probably benign 0.15
IGL01090:Or7g18 APN 9 18,787,538 (GRCm39) missense probably benign 0.00
IGL01613:Or7g18 APN 9 18,786,617 (GRCm39) splice site probably benign
IGL01987:Or7g18 APN 9 18,787,003 (GRCm39) missense probably benign 0.00
IGL03018:Or7g18 APN 9 18,787,523 (GRCm39) missense probably benign 0.15
IGL03037:Or7g18 APN 9 18,786,668 (GRCm39) missense probably damaging 0.98
R0284:Or7g18 UTSW 9 18,786,848 (GRCm39) missense probably benign
R1322:Or7g18 UTSW 9 18,786,817 (GRCm39) missense possibly damaging 0.90
R1715:Or7g18 UTSW 9 18,787,090 (GRCm39) missense probably benign 0.06
R1803:Or7g18 UTSW 9 18,787,376 (GRCm39) missense probably damaging 1.00
R4360:Or7g18 UTSW 9 18,787,013 (GRCm39) missense probably damaging 1.00
R4394:Or7g18 UTSW 9 18,786,907 (GRCm39) missense probably damaging 0.98
R4642:Or7g18 UTSW 9 18,787,463 (GRCm39) missense probably damaging 1.00
R4796:Or7g18 UTSW 9 18,787,475 (GRCm39) missense probably damaging 0.96
R4814:Or7g18 UTSW 9 18,787,213 (GRCm39) missense probably benign 0.30
R5210:Or7g18 UTSW 9 18,787,103 (GRCm39) missense probably damaging 1.00
R5375:Or7g18 UTSW 9 18,787,442 (GRCm39) missense probably benign 0.08
R6072:Or7g18 UTSW 9 18,786,718 (GRCm39) missense probably benign
R6361:Or7g18 UTSW 9 18,787,027 (GRCm39) missense probably damaging 1.00
R6920:Or7g18 UTSW 9 18,786,821 (GRCm39) missense probably damaging 1.00
R7730:Or7g18 UTSW 9 18,786,709 (GRCm39) missense probably benign 0.00
R7780:Or7g18 UTSW 9 18,786,910 (GRCm39) missense possibly damaging 0.65
R8245:Or7g18 UTSW 9 18,787,126 (GRCm39) missense probably benign
R8274:Or7g18 UTSW 9 18,786,795 (GRCm39) missense probably benign 0.36
R8920:Or7g18 UTSW 9 18,787,394 (GRCm39) missense probably damaging 1.00
R9564:Or7g18 UTSW 9 18,786,640 (GRCm39) missense probably benign 0.00
X0026:Or7g18 UTSW 9 18,786,931 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTTGGAGTAATGGCTTATGATC -3'
(R):5'- TGACAAATGAGACCCACAGG -3'

Sequencing Primer
(F):5'- ATGGCTTATGATCGCTACATAGCC -3'
(R):5'- ACAGGTGGAAAAGGCTTTGTACTTTC -3'
Posted On 2018-06-22