Incidental Mutation 'R6602:Olfr867'
ID525363
Institutional Source Beutler Lab
Gene Symbol Olfr867
Ensembl Gene ENSMUSG00000044454
Gene Nameolfactory receptor 867
SynonymsMOR143-2, GA_x6K02T2PVTD-13795933-13794938
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20050955-20057562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20055046 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 139 (R139Q)
Ref Sequence ENSEMBL: ENSMUSP00000150378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060780] [ENSMUST00000212098] [ENSMUST00000216538]
Predicted Effect probably benign
Transcript: ENSMUST00000060780
AA Change: R139Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057469
Gene: ENSMUSG00000044454
AA Change: R139Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 301 1.6e-6 PFAM
Pfam:7tm_1 41 290 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212098
AA Change: R21Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000216538
AA Change: R139Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Olfr867
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Olfr867 APN 9 20054900 missense probably benign 0.01
IGL03130:Olfr867 APN 9 20055372 missense probably benign 0.34
R1034:Olfr867 UTSW 9 20055365 missense probably benign 0.02
R1238:Olfr867 UTSW 9 20055461 start codon destroyed probably benign 0.12
R1412:Olfr867 UTSW 9 20055415 missense possibly damaging 0.65
R1625:Olfr867 UTSW 9 20055382 missense probably damaging 1.00
R1689:Olfr867 UTSW 9 20055126 missense possibly damaging 0.94
R2060:Olfr867 UTSW 9 20054596 missense probably damaging 1.00
R2204:Olfr867 UTSW 9 20055211 missense possibly damaging 0.74
R2350:Olfr867 UTSW 9 20055088 missense probably damaging 1.00
R3901:Olfr867 UTSW 9 20054873 missense probably benign 0.00
R5637:Olfr867 UTSW 9 20054983 missense possibly damaging 0.80
R6084:Olfr867 UTSW 9 20054883 missense possibly damaging 0.71
R6150:Olfr867 UTSW 9 20054874 missense probably benign 0.22
R6902:Olfr867 UTSW 9 20055374 missense possibly damaging 0.47
R6946:Olfr867 UTSW 9 20055374 missense possibly damaging 0.47
R7085:Olfr867 UTSW 9 20054936 missense probably benign 0.37
R7678:Olfr867 UTSW 9 20054605 missense probably damaging 1.00
R8034:Olfr867 UTSW 9 20055005 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCATAGGAATCACACCCAG -3'
(R):5'- AAAGATGCTAGTGAACATGCAGTC -3'

Sequencing Primer
(F):5'- TGTCATAGGAATCACACCCAGTAAGG -3'
(R):5'- TGCAGTCACAGATAAAAGACATCTC -3'
Posted On2018-06-22