Incidental Mutation 'R6602:Rsl24d1'
ID525365
Institutional Source Beutler Lab
Gene Symbol Rsl24d1
Ensembl Gene ENSMUSG00000032215
Gene Nameribosomal L24 domain containing 1
Synonyms2410159K22Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R6602 (G1)
Quality Score108.008
Status Validated
Chromosome9
Chromosomal Location73113426-73123333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73113510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 3 (I3N)
Ref Sequence ENSEMBL: ENSMUSP00000109133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034738] [ENSMUST00000113505] [ENSMUST00000165177] [ENSMUST00000169399] [ENSMUST00000174203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034738
AA Change: I3N

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034738
Gene: ENSMUSG00000032215
AA Change: I3N

DomainStartEndE-ValueType
TRASH 6 44 1.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113505
AA Change: I3N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000165177
SMART Domains Protein: ENSMUSP00000126553
Gene: ENSMUSG00000032215

DomainStartEndE-ValueType
Pfam:Ribosomal_L24e 18 67 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169399
Predicted Effect probably benign
Transcript: ENSMUST00000174203
SMART Domains Protein: ENSMUSP00000134473
Gene: ENSMUSG00000092310

DomainStartEndE-ValueType
internal_repeat_1 116 173 5.47e-9 PROSPERO
internal_repeat_1 177 233 5.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein sharing a low level of sequence similarity with human ribosomal protein L24. Although this gene has been referred to as RPL24, L30, and 60S ribosomal protein L30 isolog in the sequence databases, it is distinct from the human genes officially named RPL24 (which itself has been referred to as ribosomal protein L30) and RPL30. The protein encoded by this gene localizes to the nucleolus and is thought to play a role in the biogenesis of the 60S ribosomal subunit. The precise function of this gene is currently unknown. This gene utilizes alternative polyadenylation signals and has multiple pseudogenes. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Rsl24d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03296:Rsl24d1 APN 9 73117947 critical splice donor site probably null
R1953:Rsl24d1 UTSW 9 73114614 intron probably benign
R2909:Rsl24d1 UTSW 9 73122303 missense probably damaging 0.97
R5320:Rsl24d1 UTSW 9 73116416 missense possibly damaging 0.47
R6701:Rsl24d1 UTSW 9 73114997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCAGTCTATAGCCTCTGC -3'
(R):5'- TCTGACAGCAACGAGGAGAC -3'

Sequencing Primer
(F):5'- GCAGTCTATAGCCTCTGCGTCTG -3'
(R):5'- ACCTCGCCGGCAGTGAAC -3'
Posted On2018-06-22