Incidental Mutation 'R6602:Pitpna'
ID 525370
Institutional Source Beutler Lab
Gene Symbol Pitpna
Ensembl Gene ENSMUSG00000017781
Gene Name phosphatidylinositol transfer protein, alpha
Synonyms Pitpn, Pitp alpha
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 75588097-75628804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 75620315 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 238 (V238G)
Ref Sequence ENSEMBL: ENSMUSP00000137510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102509] [ENSMUST00000143219] [ENSMUST00000179445] [ENSMUST00000179521]
AlphaFold P53810
Predicted Effect probably benign
Transcript: ENSMUST00000102509
SMART Domains Protein: ENSMUSP00000099567
Gene: ENSMUSG00000017781

DomainStartEndE-ValueType
Pfam:IP_trans 2 99 1e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143219
AA Change: V237G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115723
Gene: ENSMUSG00000017781
AA Change: V237G

DomainStartEndE-ValueType
Pfam:IP_trans 2 255 4.7e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153768
Predicted Effect possibly damaging
Transcript: ENSMUST00000179445
AA Change: V237G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137601
Gene: ENSMUSG00000017781
AA Change: V237G

DomainStartEndE-ValueType
Pfam:IP_trans 2 255 6.7e-146 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179521
AA Change: V238G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137510
Gene: ENSMUSG00000017781
AA Change: V238G

DomainStartEndE-ValueType
Pfam:IP_trans 2 254 3.2e-123 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of a family of lipid-binding proteins that transfer molecules of phosphatidylinositol or phosphatidylcholine between membrane surfaces. The protein is implicated in phospholipase C signaling and in the production of phosphatidylinositol 3,4,5-trisphosphate by phosphoinositide-3-kinase. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations of this gene result in motor coordination abnormalities and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Pitpna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Pitpna APN 11 75612250 missense probably benign
R0111:Pitpna UTSW 11 75625484 missense probably benign 0.03
R1854:Pitpna UTSW 11 75609103 critical splice acceptor site probably null
R3017:Pitpna UTSW 11 75592190 missense probably damaging 1.00
R4779:Pitpna UTSW 11 75620327 missense possibly damaging 0.83
R5622:Pitpna UTSW 11 75620327 missense possibly damaging 0.83
R5685:Pitpna UTSW 11 75620269 missense probably damaging 1.00
R6539:Pitpna UTSW 11 75598301 missense probably damaging 1.00
R6937:Pitpna UTSW 11 75603731 missense possibly damaging 0.79
R9584:Pitpna UTSW 11 75619542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTAACCTGCCAGAAACAGTTTG -3'
(R):5'- CAACAGAGCCAGGCTTGTTC -3'

Sequencing Primer
(F):5'- CAGTTTGGCAAAGGTCACTGAC -3'
(R):5'- CAGAGCCAGGCTTGTTCTTAGAAC -3'
Posted On 2018-06-22