Incidental Mutation 'R6602:Greb1'
ID 525374
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 16720616-16850887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16759441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 652 (V652E)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect probably benign
Transcript: ENSMUST00000048064
AA Change: V652E

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: V652E

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159044
Predicted Effect probably benign
Transcript: ENSMUST00000159120
AA Change: V652E

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: V652E

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160347
SMART Domains Protein: ENSMUSP00000124897
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 121 4.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160575
Predicted Effect unknown
Transcript: ENSMUST00000160627
AA Change: V117E
SMART Domains Protein: ENSMUSP00000124922
Gene: ENSMUSG00000036523
AA Change: V117E

DomainStartEndE-ValueType
Pfam:GREB1 1 122 1.8e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably benign
Transcript: ENSMUST00000162112
AA Change: V652E

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: V652E

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Abca4 A C 3: 121,932,150 (GRCm39) Q268P probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Or7g18 A G 9: 18,787,145 (GRCm39) D174G possibly damaging Het
Pcdhb18 A T 18: 37,623,533 (GRCm39) I288F probably damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc34a3 A G 2: 25,119,221 (GRCm39) S550P probably damaging Het
Slc4a1ap A G 5: 31,684,985 (GRCm39) H207R probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Ubqln5 T A 7: 103,778,696 (GRCm39) S43C probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,816 (GRCm39) V413D probably damaging Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16,761,962 (GRCm39) missense probably damaging 1.00
IGL01316:Greb1 APN 12 16,748,587 (GRCm39) missense probably benign 0.04
IGL01464:Greb1 APN 12 16,764,827 (GRCm39) missense probably damaging 0.99
IGL01474:Greb1 APN 12 16,734,502 (GRCm39) missense probably benign
IGL01522:Greb1 APN 12 16,751,202 (GRCm39) missense probably damaging 1.00
IGL01824:Greb1 APN 12 16,761,717 (GRCm39) nonsense probably null
IGL01837:Greb1 APN 12 16,734,452 (GRCm39) missense probably benign 0.19
IGL01991:Greb1 APN 12 16,749,682 (GRCm39) missense probably damaging 1.00
IGL01996:Greb1 APN 12 16,740,846 (GRCm39) missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16,756,233 (GRCm39) missense probably damaging 1.00
IGL02267:Greb1 APN 12 16,767,209 (GRCm39) missense probably benign 0.00
IGL02512:Greb1 APN 12 16,742,713 (GRCm39) missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16,756,296 (GRCm39) splice site probably benign
IGL02613:Greb1 APN 12 16,789,889 (GRCm39) critical splice donor site probably null
IGL02648:Greb1 APN 12 16,758,683 (GRCm39) missense probably damaging 1.00
IGL02679:Greb1 APN 12 16,758,724 (GRCm39) missense probably damaging 1.00
begraben UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
Eared UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
Humpback UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
pied_billed UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
rednecked UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16,783,332 (GRCm39) missense probably damaging 1.00
R0083:Greb1 UTSW 12 16,746,452 (GRCm39) missense probably benign
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0220:Greb1 UTSW 12 16,732,287 (GRCm39) missense probably damaging 1.00
R0245:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0540:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0547:Greb1 UTSW 12 16,773,412 (GRCm39) missense probably benign
R0563:Greb1 UTSW 12 16,730,268 (GRCm39) missense probably benign 0.23
R0607:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0610:Greb1 UTSW 12 16,746,443 (GRCm39) missense probably benign
R0652:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0659:Greb1 UTSW 12 16,730,213 (GRCm39) missense probably damaging 0.99
R0945:Greb1 UTSW 12 16,723,803 (GRCm39) missense probably benign 0.31
R1055:Greb1 UTSW 12 16,732,252 (GRCm39) missense probably damaging 0.98
R1445:Greb1 UTSW 12 16,757,852 (GRCm39) missense probably damaging 1.00
R1471:Greb1 UTSW 12 16,761,775 (GRCm39) missense probably damaging 0.97
R1503:Greb1 UTSW 12 16,774,820 (GRCm39) nonsense probably null
R1566:Greb1 UTSW 12 16,761,829 (GRCm39) missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
R1623:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R1751:Greb1 UTSW 12 16,773,439 (GRCm39) splice site probably benign
R1778:Greb1 UTSW 12 16,740,895 (GRCm39) missense probably benign
R1842:Greb1 UTSW 12 16,746,244 (GRCm39) missense probably damaging 1.00
R2040:Greb1 UTSW 12 16,752,651 (GRCm39) missense probably damaging 1.00
R2153:Greb1 UTSW 12 16,749,533 (GRCm39) missense probably damaging 1.00
R2178:Greb1 UTSW 12 16,746,388 (GRCm39) missense probably damaging 1.00
R2194:Greb1 UTSW 12 16,740,909 (GRCm39) missense probably benign 0.08
R2248:Greb1 UTSW 12 16,730,379 (GRCm39) missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16,764,954 (GRCm39) missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16,774,923 (GRCm39) missense probably damaging 1.00
R2860:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2861:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2862:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2866:Greb1 UTSW 12 16,749,551 (GRCm39) missense probably damaging 1.00
R2890:Greb1 UTSW 12 16,754,479 (GRCm39) missense probably damaging 1.00
R3056:Greb1 UTSW 12 16,738,592 (GRCm39) missense probably damaging 0.96
R3863:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3864:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3956:Greb1 UTSW 12 16,732,300 (GRCm39) missense probably damaging 1.00
R4493:Greb1 UTSW 12 16,748,611 (GRCm39) missense probably benign 0.14
R4548:Greb1 UTSW 12 16,749,676 (GRCm39) missense probably damaging 1.00
R4683:Greb1 UTSW 12 16,761,774 (GRCm39) missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16,746,329 (GRCm39) missense probably damaging 1.00
R4770:Greb1 UTSW 12 16,731,357 (GRCm39) missense probably benign 0.03
R4838:Greb1 UTSW 12 16,734,361 (GRCm39) critical splice donor site probably null
R4925:Greb1 UTSW 12 16,731,472 (GRCm39) missense probably damaging 1.00
R4982:Greb1 UTSW 12 16,774,762 (GRCm39) missense probably damaging 0.98
R5009:Greb1 UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16,758,023 (GRCm39) intron probably benign
R5213:Greb1 UTSW 12 16,764,791 (GRCm39) nonsense probably null
R5310:Greb1 UTSW 12 16,766,760 (GRCm39) missense probably benign 0.09
R5353:Greb1 UTSW 12 16,738,567 (GRCm39) nonsense probably null
R5544:Greb1 UTSW 12 16,723,797 (GRCm39) missense probably damaging 1.00
R5605:Greb1 UTSW 12 16,758,727 (GRCm39) missense probably damaging 0.96
R5708:Greb1 UTSW 12 16,723,843 (GRCm39) missense probably benign 0.11
R5837:Greb1 UTSW 12 16,738,586 (GRCm39) missense probably damaging 1.00
R5890:Greb1 UTSW 12 16,783,422 (GRCm39) missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16,767,259 (GRCm39) missense probably damaging 1.00
R6049:Greb1 UTSW 12 16,731,395 (GRCm39) missense probably damaging 0.99
R6093:Greb1 UTSW 12 16,734,487 (GRCm39) missense probably benign
R6120:Greb1 UTSW 12 16,758,622 (GRCm39) missense probably damaging 0.99
R6175:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R6247:Greb1 UTSW 12 16,766,676 (GRCm39) missense probably damaging 1.00
R6274:Greb1 UTSW 12 16,785,152 (GRCm39) missense probably damaging 0.97
R6376:Greb1 UTSW 12 16,749,580 (GRCm39) missense probably damaging 0.97
R6523:Greb1 UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16,760,384 (GRCm39) missense probably benign 0.00
R6621:Greb1 UTSW 12 16,742,718 (GRCm39) missense probably damaging 1.00
R6645:Greb1 UTSW 12 16,748,580 (GRCm39) missense probably benign 0.07
R6725:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
R6750:Greb1 UTSW 12 16,738,584 (GRCm39) missense probably benign 0.05
R6863:Greb1 UTSW 12 16,734,421 (GRCm39) missense probably damaging 1.00
R6914:Greb1 UTSW 12 16,757,903 (GRCm39) missense probably damaging 0.97
R6996:Greb1 UTSW 12 16,773,355 (GRCm39) missense probably benign 0.00
R7083:Greb1 UTSW 12 16,773,315 (GRCm39) missense probably benign
R7147:Greb1 UTSW 12 16,783,428 (GRCm39) missense probably damaging 1.00
R7238:Greb1 UTSW 12 16,724,673 (GRCm39) missense probably damaging 0.99
R7290:Greb1 UTSW 12 16,761,739 (GRCm39) missense probably damaging 1.00
R7358:Greb1 UTSW 12 16,774,882 (GRCm39) missense probably damaging 1.00
R7395:Greb1 UTSW 12 16,759,431 (GRCm39) critical splice donor site probably null
R7526:Greb1 UTSW 12 16,766,766 (GRCm39) missense probably benign 0.00
R7530:Greb1 UTSW 12 16,767,207 (GRCm39) missense probably benign 0.02
R7536:Greb1 UTSW 12 16,732,186 (GRCm39) missense probably damaging 1.00
R7643:Greb1 UTSW 12 16,761,997 (GRCm39) missense probably damaging 0.99
R7732:Greb1 UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
R7740:Greb1 UTSW 12 16,790,122 (GRCm39) start gained probably benign
R7747:Greb1 UTSW 12 16,724,796 (GRCm39) missense probably benign 0.01
R7760:Greb1 UTSW 12 16,773,417 (GRCm39) missense probably benign
R7937:Greb1 UTSW 12 16,766,670 (GRCm39) missense probably damaging 0.99
R8043:Greb1 UTSW 12 16,761,790 (GRCm39) missense probably damaging 1.00
R8259:Greb1 UTSW 12 16,774,925 (GRCm39) nonsense probably null
R8553:Greb1 UTSW 12 16,773,328 (GRCm39) missense probably benign 0.00
R8559:Greb1 UTSW 12 16,746,436 (GRCm39) missense probably damaging 1.00
R8690:Greb1 UTSW 12 16,746,548 (GRCm39) missense probably benign 0.03
R8830:Greb1 UTSW 12 16,738,520 (GRCm39) missense probably benign 0.35
R8911:Greb1 UTSW 12 16,740,903 (GRCm39) missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16,774,885 (GRCm39) missense probably damaging 1.00
R8986:Greb1 UTSW 12 16,734,457 (GRCm39) missense probably damaging 0.99
R9013:Greb1 UTSW 12 16,789,970 (GRCm39) missense probably damaging 1.00
R9279:Greb1 UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
R9360:Greb1 UTSW 12 16,790,037 (GRCm39) missense probably damaging 1.00
R9563:Greb1 UTSW 12 16,774,824 (GRCm39) missense probably benign 0.06
R9616:Greb1 UTSW 12 16,790,038 (GRCm39) missense probably damaging 1.00
R9627:Greb1 UTSW 12 16,756,167 (GRCm39) missense probably damaging 1.00
R9731:Greb1 UTSW 12 16,738,598 (GRCm39) missense probably damaging 1.00
R9761:Greb1 UTSW 12 16,751,275 (GRCm39) missense probably benign 0.05
Z1176:Greb1 UTSW 12 16,746,757 (GRCm39) missense probably benign 0.00
Z1177:Greb1 UTSW 12 16,752,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACATACCTGAGACGCCTG -3'
(R):5'- CATGACTTCAGGCCAAGAGCAG -3'

Sequencing Primer
(F):5'- TACCTGAGACGCCTGTGCATAC -3'
(R):5'- CACAGTAGCTGGTCCAGGTTTG -3'
Posted On 2018-06-22