Incidental Mutation 'R6634:Ebf3'
ID525383
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Nameearly B cell factor 3
SynonymsOlf-1/EBF-like 2, O/E-2, 3110018A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6634 (G1)
Quality Score194.009
Status Validated
Chromosome7
Chromosomal Location137193673-137314445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137201160 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 387 (V387A)
Ref Sequence ENSEMBL: ENSMUSP00000147829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000209578] [ENSMUST00000210774]
Predicted Effect probably damaging
Transcript: ENSMUST00000033378
AA Change: V378A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106118
AA Change: V378A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: V378A

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168203
AA Change: V378A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169486
AA Change: V378A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209578
AA Change: V171A

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209650
Predicted Effect probably damaging
Transcript: ENSMUST00000210774
AA Change: V387A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,236,930 probably null Het
Alox12b C A 11: 69,168,821 Y566* probably null Het
Chl1 T A 6: 103,690,259 S403R probably damaging Het
Cpa5 T A 6: 30,626,364 D241E probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2t4 C A 7: 27,155,788 C121* probably null Het
Dkkl1 C A 7: 45,210,458 R56L possibly damaging Het
Fer1l5 A G 1: 36,411,385 T1212A probably damaging Het
Galnt16 T A 12: 80,519,170 M1K probably null Het
Gm11639 T C 11: 104,893,783 M2797T probably benign Het
Gm5800 A G 14: 51,716,138 S7P possibly damaging Het
Gstp1 T A 19: 4,035,510 H199L probably benign Het
Herc1 T C 9: 66,437,744 S1940P probably benign Het
Igkv8-24 C T 6: 70,217,381 W14* probably null Het
Iqcd C A 5: 120,600,491 Q125K probably benign Het
Lpin2 T A 17: 71,246,418 D812E probably damaging Het
Ltb4r2 T A 14: 55,762,505 probably null Het
Morc2a T C 11: 3,672,376 probably null Het
Myh1 A T 11: 67,209,064 N600I possibly damaging Het
Nedd9 T A 13: 41,312,108 K685N probably damaging Het
Olfr432 A G 1: 174,050,969 I199V probably benign Het
Otogl A C 10: 107,862,304 V735G probably damaging Het
Pcnx T A 12: 81,917,882 Y274* probably null Het
Pias1 A T 9: 62,919,424 I252N probably damaging Het
Pitpnm3 T C 11: 72,051,929 D844G probably null Het
Satb2 G T 1: 56,845,721 S348* probably null Het
Sfxn1 T A 13: 54,093,029 V180D probably damaging Het
Slc35g3 A T 11: 69,760,283 V314D probably damaging Het
Tmem200c C A 17: 68,842,106 D561E probably benign Het
Usp53 T A 3: 122,964,286 Q69L probably benign Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R0962:Ebf3 UTSW 7 137225203 missense probably damaging 0.99
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4298:Ebf3 UTSW 7 137225229 missense possibly damaging 0.95
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5061:Ebf3 UTSW 7 137313559 missense possibly damaging 0.57
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
R7578:Ebf3 UTSW 7 137313532 missense probably damaging 1.00
R7771:Ebf3 UTSW 7 137309363 missense probably damaging 1.00
R8133:Ebf3 UTSW 7 137313143 missense probably damaging 1.00
RF022:Ebf3 UTSW 7 137313942 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACTCCCCTTTGTGAGCCAC -3'
(R):5'- AACTTTGAAAGACCCAGCAGG -3'

Sequencing Primer
(F):5'- GTGAGCCACCCTCCTCAACTG -3'
(R):5'- CACCTGTGTTTGCCTTTCAGAGAG -3'
Posted On2018-06-22