Incidental Mutation 'R6602:Btnl1'
ID525388
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Namebutyrophilin-like 1
SynonymsBtnl3, LOC240074, LOC240074, NG10
Accession Numbers

Genbank: NM_001111094; MGI: 1932027

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34377132-34385776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34385748 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 501 (M501K)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
Predicted Effect probably damaging
Transcript: ENSMUST00000080254
AA Change: M501K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: M501K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34381117 missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34385685 missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34379535 missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34382265 missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34385512 missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34381056 missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0371:Btnl1 UTSW 17 34381057 missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34381208 nonsense probably null
R1982:Btnl1 UTSW 17 34379751 missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34379604 missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34385634 missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34381038 missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34381159 missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34382462 missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34379725 missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34379751 missense probably null 0.99
R5579:Btnl1 UTSW 17 34381552 critical splice donor site probably null
R5811:Btnl1 UTSW 17 34385529 missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R6633:Btnl1 UTSW 17 34385331 missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34385673 missense possibly damaging 0.86
RF041:Btnl1 UTSW 17 34381368 missense probably benign 0.04
X0026:Btnl1 UTSW 17 34377932 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGATACAGGGCTCTTGACTTC -3'
(R):5'- ATGCACGACACAGATGGTCC -3'

Sequencing Primer
(F):5'- GATACAGGGCTCTTGACTTCTGTTC -3'
(R):5'- CACAGATGGTCCGAGAATCTTGTC -3'
Posted On2018-06-22