Incidental Mutation 'R6602:Pcdhb18'
ID 525393
Institutional Source Beutler Lab
Gene Symbol Pcdhb18
Ensembl Gene ENSMUSG00000048347
Gene Name protocadherin beta 18
Synonyms Pcdhb9, PcdhbR
Accession Numbers
Essential gene? Probably non essential (E-score: 0.236) question?
Stock # R6602 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37622524-37627558 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37623533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 288 (I288F)
Ref Sequence ENSEMBL: ENSMUSP00000052113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91Y02
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055949
AA Change: I288F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347
AA Change: I288F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,365,993 (GRCm39) L250P probably damaging Het
4921539E11Rik T C 4: 103,112,769 (GRCm39) H12R probably benign Het
Abca4 A C 3: 121,932,150 (GRCm39) Q268P probably benign Het
Adgrf5 T A 17: 43,761,195 (GRCm39) N963K probably benign Het
Arl10 A G 13: 54,726,750 (GRCm39) D176G probably damaging Het
Btnl1 T A 17: 34,604,722 (GRCm39) M501K probably damaging Het
Ccdc162 G T 10: 41,491,976 (GRCm39) T1079K probably benign Het
Cd163 T A 6: 124,288,594 (GRCm39) W342R probably damaging Het
Cd70 T C 17: 57,456,562 (GRCm39) S14G probably benign Het
Chil4 C A 3: 106,117,906 (GRCm39) K121N probably benign Het
Csf1r A G 18: 61,243,497 (GRCm39) D171G possibly damaging Het
Cyp4a31 A T 4: 115,426,904 (GRCm39) probably null Het
Dapk1 A T 13: 60,897,018 (GRCm39) I746F probably benign Het
Erbb4 A G 1: 68,409,662 (GRCm39) S192P probably damaging Het
Exoc8 C A 8: 125,623,150 (GRCm39) V406L probably damaging Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Greb1 A T 12: 16,759,441 (GRCm39) V652E probably benign Het
Ift88 A G 14: 57,744,716 (GRCm39) S745G probably benign Het
Il18bp T C 7: 101,665,237 (GRCm39) probably benign Het
Il6st A G 13: 112,640,947 (GRCm39) T908A probably damaging Het
Klk1b11 A G 7: 43,424,198 (GRCm39) S6G probably benign Het
Mastl T C 2: 23,022,689 (GRCm39) Y678C probably benign Het
Msra A T 14: 64,360,788 (GRCm39) H184Q probably benign Het
Muc16 A C 9: 18,520,772 (GRCm39) probably null Het
Myo3a T G 2: 22,467,799 (GRCm39) L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 67,134,192 (GRCm39) probably null Het
Or4d2 T C 11: 87,784,478 (GRCm39) T91A probably benign Het
Or7d11 C T 9: 19,966,342 (GRCm39) R139Q probably benign Het
Or7g18 A G 9: 18,787,145 (GRCm39) D174G possibly damaging Het
Pitpna T G 11: 75,511,141 (GRCm39) V238G possibly damaging Het
Ppfibp1 T A 6: 146,879,719 (GRCm39) V81E possibly damaging Het
Rab11fip2 T A 19: 59,931,288 (GRCm39) T49S probably damaging Het
Rsl24d1 T A 9: 73,020,792 (GRCm39) I3N possibly damaging Het
Rtn1 T C 12: 72,266,092 (GRCm39) N161S probably damaging Het
Shank1 A G 7: 44,001,760 (GRCm39) I1151V probably benign Het
Slc34a3 A G 2: 25,119,221 (GRCm39) S550P probably damaging Het
Slc4a1ap A G 5: 31,684,985 (GRCm39) H207R probably damaging Het
Sphkap T A 1: 83,253,479 (GRCm39) K1423N possibly damaging Het
Ttn A G 2: 76,712,097 (GRCm39) probably benign Het
Ubqln5 T A 7: 103,778,696 (GRCm39) S43C probably benign Het
Vps13d G A 4: 144,830,234 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,816 (GRCm39) V413D probably damaging Het
Zfp267 G T 3: 36,219,004 (GRCm39) L341F possibly damaging Het
Other mutations in Pcdhb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhb18 APN 18 37,624,984 (GRCm39) missense probably benign 0.35
IGL02651:Pcdhb18 APN 18 37,624,234 (GRCm39) nonsense probably null
IGL02721:Pcdhb18 APN 18 37,623,084 (GRCm39) missense probably benign 0.33
IGL02945:Pcdhb18 APN 18 37,623,048 (GRCm39) missense probably benign 0.34
IGL03030:Pcdhb18 APN 18 37,623,786 (GRCm39) missense probably damaging 1.00
IGL03346:Pcdhb18 APN 18 37,622,674 (GRCm39) start codon destroyed probably null 0.99
R0206:Pcdhb18 UTSW 18 37,623,240 (GRCm39) missense possibly damaging 0.80
R0208:Pcdhb18 UTSW 18 37,623,240 (GRCm39) missense possibly damaging 0.80
R0680:Pcdhb18 UTSW 18 37,623,347 (GRCm39) missense probably damaging 0.98
R1517:Pcdhb18 UTSW 18 37,622,673 (GRCm39) start codon destroyed probably null 1.00
R1519:Pcdhb18 UTSW 18 37,623,945 (GRCm39) missense probably damaging 1.00
R1597:Pcdhb18 UTSW 18 37,624,820 (GRCm39) missense probably benign 0.19
R1735:Pcdhb18 UTSW 18 37,623,822 (GRCm39) missense probably benign 0.00
R2089:Pcdhb18 UTSW 18 37,623,653 (GRCm39) missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37,623,653 (GRCm39) missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37,623,653 (GRCm39) missense probably damaging 0.99
R2206:Pcdhb18 UTSW 18 37,624,342 (GRCm39) missense probably damaging 0.99
R2207:Pcdhb18 UTSW 18 37,624,342 (GRCm39) missense probably damaging 0.99
R4773:Pcdhb18 UTSW 18 37,623,507 (GRCm39) missense probably damaging 1.00
R4837:Pcdhb18 UTSW 18 37,622,867 (GRCm39) missense probably damaging 1.00
R5271:Pcdhb18 UTSW 18 37,624,649 (GRCm39) missense possibly damaging 0.94
R5568:Pcdhb18 UTSW 18 37,624,853 (GRCm39) missense probably benign 0.44
R5647:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5648:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5690:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5692:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5812:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5813:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5928:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5929:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R5930:Pcdhb18 UTSW 18 37,624,988 (GRCm39) missense possibly damaging 0.63
R6209:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R6255:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.05
R6699:Pcdhb18 UTSW 18 37,625,005 (GRCm39) missense probably benign 0.00
R7055:Pcdhb18 UTSW 18 37,623,864 (GRCm39) missense possibly damaging 0.64
R7197:Pcdhb18 UTSW 18 37,623,436 (GRCm39) missense probably benign 0.06
R7289:Pcdhb18 UTSW 18 37,623,700 (GRCm39) missense probably damaging 1.00
R7345:Pcdhb18 UTSW 18 37,624,976 (GRCm39) missense probably benign 0.19
R7403:Pcdhb18 UTSW 18 37,624,950 (GRCm39) missense probably benign 0.09
R7541:Pcdhb18 UTSW 18 37,624,662 (GRCm39) missense probably damaging 1.00
R7651:Pcdhb18 UTSW 18 37,624,046 (GRCm39) missense probably benign 0.00
R7670:Pcdhb18 UTSW 18 37,624,749 (GRCm39) missense probably damaging 1.00
R7673:Pcdhb18 UTSW 18 37,624,790 (GRCm39) missense probably benign 0.39
R7783:Pcdhb18 UTSW 18 37,622,874 (GRCm39) missense probably benign 0.01
R7819:Pcdhb18 UTSW 18 37,624,308 (GRCm39) missense possibly damaging 0.60
R7826:Pcdhb18 UTSW 18 37,623,995 (GRCm39) missense probably damaging 0.98
R7857:Pcdhb18 UTSW 18 37,624,364 (GRCm39) missense probably benign
R7866:Pcdhb18 UTSW 18 37,623,512 (GRCm39) missense probably damaging 0.99
R7895:Pcdhb18 UTSW 18 37,623,520 (GRCm39) missense probably benign 0.27
R8773:Pcdhb18 UTSW 18 37,624,562 (GRCm39) missense probably damaging 1.00
R8810:Pcdhb18 UTSW 18 37,623,374 (GRCm39) missense probably benign 0.00
R8891:Pcdhb18 UTSW 18 37,623,700 (GRCm39) missense probably damaging 1.00
R8938:Pcdhb18 UTSW 18 37,623,537 (GRCm39) missense probably benign 0.00
R9303:Pcdhb18 UTSW 18 37,625,004 (GRCm39) missense probably benign
R9305:Pcdhb18 UTSW 18 37,625,004 (GRCm39) missense probably benign
R9525:Pcdhb18 UTSW 18 37,624,887 (GRCm39) missense probably damaging 1.00
R9608:Pcdhb18 UTSW 18 37,623,694 (GRCm39) missense probably damaging 1.00
R9696:Pcdhb18 UTSW 18 37,623,606 (GRCm39) missense possibly damaging 0.94
X0022:Pcdhb18 UTSW 18 37,623,326 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACTCACTGCACTTGATGGTG -3'
(R):5'- TTCAGGGGCGTTGTCATTAAC -3'

Sequencing Primer
(F):5'- GGGACAGCCACTATACATATTCTGG -3'
(R):5'- CGTTGTCATTAACGTCTAAAACCCG -3'
Posted On 2018-06-22