Incidental Mutation 'R6602:Pcdhb18'
ID525393
Institutional Source Beutler Lab
Gene Symbol Pcdhb18
Ensembl Gene ENSMUSG00000048347
Gene Nameprotocadherin beta 18
SynonymsPcdhbR, Pcdhb9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37489465-37494505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37490480 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 288 (I288F)
Ref Sequence ENSEMBL: ENSMUSP00000052113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055949
AA Change: I288F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347
AA Change: I288F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Pcdhb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhb18 APN 18 37491931 missense probably benign 0.35
IGL02651:Pcdhb18 APN 18 37491181 nonsense probably null
IGL02721:Pcdhb18 APN 18 37490031 missense probably benign 0.33
IGL02945:Pcdhb18 APN 18 37489995 missense probably benign 0.34
IGL03030:Pcdhb18 APN 18 37490733 missense probably damaging 1.00
IGL03346:Pcdhb18 APN 18 37489621 start codon destroyed probably null 0.99
R0206:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0208:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0680:Pcdhb18 UTSW 18 37490294 missense probably damaging 0.98
R1517:Pcdhb18 UTSW 18 37489620 start codon destroyed probably null 1.00
R1519:Pcdhb18 UTSW 18 37490892 missense probably damaging 1.00
R1597:Pcdhb18 UTSW 18 37491767 missense probably benign 0.19
R1735:Pcdhb18 UTSW 18 37490769 missense probably benign 0.00
R2089:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2206:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R2207:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R4773:Pcdhb18 UTSW 18 37490454 missense probably damaging 1.00
R4837:Pcdhb18 UTSW 18 37489814 missense probably damaging 1.00
R5271:Pcdhb18 UTSW 18 37491596 missense possibly damaging 0.94
R5568:Pcdhb18 UTSW 18 37491800 missense probably benign 0.44
R5647:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5648:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5690:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5692:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5812:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5813:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5928:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5929:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5930:Pcdhb18 UTSW 18 37491935 missense possibly damaging 0.63
R6209:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6255:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6699:Pcdhb18 UTSW 18 37491952 missense probably benign 0.00
R7055:Pcdhb18 UTSW 18 37490811 missense possibly damaging 0.64
R7197:Pcdhb18 UTSW 18 37490383 missense probably benign 0.06
R7289:Pcdhb18 UTSW 18 37490647 missense probably damaging 1.00
R7345:Pcdhb18 UTSW 18 37491923 missense probably benign 0.19
R7403:Pcdhb18 UTSW 18 37491897 missense probably benign 0.09
R7541:Pcdhb18 UTSW 18 37491609 missense probably damaging 1.00
R7651:Pcdhb18 UTSW 18 37490993 missense probably benign 0.00
R7670:Pcdhb18 UTSW 18 37491696 missense probably damaging 1.00
R7673:Pcdhb18 UTSW 18 37491737 missense probably benign 0.39
X0022:Pcdhb18 UTSW 18 37490273 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACTCACTGCACTTGATGGTG -3'
(R):5'- TTCAGGGGCGTTGTCATTAAC -3'

Sequencing Primer
(F):5'- GGGACAGCCACTATACATATTCTGG -3'
(R):5'- CGTTGTCATTAACGTCTAAAACCCG -3'
Posted On2018-06-22