Incidental Mutation 'R6634:Sfxn1'
ID525409
Institutional Source Beutler Lab
Gene Symbol Sfxn1
Ensembl Gene ENSMUSG00000021474
Gene Namesideroflexin 1
Synonyms2810002O05Rik, A930015P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6634 (G1)
Quality Score201.009
Status Validated
Chromosome13
Chromosomal Location54071869-54108342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54093029 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 180 (V180D)
Ref Sequence ENSEMBL: ENSMUSP00000021930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021930]
Predicted Effect probably damaging
Transcript: ENSMUST00000021930
AA Change: V180D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021930
Gene: ENSMUSG00000021474
AA Change: V180D

DomainStartEndE-ValueType
Pfam:Mtc 16 322 8.3e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223504
Meta Mutation Damage Score 0.9434 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,236,930 probably null Het
Alox12b C A 11: 69,168,821 Y566* probably null Het
Chl1 T A 6: 103,690,259 S403R probably damaging Het
Cpa5 T A 6: 30,626,364 D241E probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2t4 C A 7: 27,155,788 C121* probably null Het
Dkkl1 C A 7: 45,210,458 R56L possibly damaging Het
Ebf3 A G 7: 137,201,160 V387A probably damaging Het
Fer1l5 A G 1: 36,411,385 T1212A probably damaging Het
Galnt16 T A 12: 80,519,170 M1K probably null Het
Gm11639 T C 11: 104,893,783 M2797T probably benign Het
Gm5800 A G 14: 51,716,138 S7P possibly damaging Het
Gstp1 T A 19: 4,035,510 H199L probably benign Het
Herc1 T C 9: 66,437,744 S1940P probably benign Het
Igkv8-24 C T 6: 70,217,381 W14* probably null Het
Iqcd C A 5: 120,600,491 Q125K probably benign Het
Lpin2 T A 17: 71,246,418 D812E probably damaging Het
Ltb4r2 T A 14: 55,762,505 probably null Het
Morc2a T C 11: 3,672,376 probably null Het
Myh1 A T 11: 67,209,064 N600I possibly damaging Het
Nedd9 T A 13: 41,312,108 K685N probably damaging Het
Olfr432 A G 1: 174,050,969 I199V probably benign Het
Otogl A C 10: 107,862,304 V735G probably damaging Het
Pcnx T A 12: 81,917,882 Y274* probably null Het
Pias1 A T 9: 62,919,424 I252N probably damaging Het
Pitpnm3 T C 11: 72,051,929 D844G probably null Het
Satb2 G T 1: 56,845,721 S348* probably null Het
Slc35g3 A T 11: 69,760,283 V314D probably damaging Het
Tmem200c C A 17: 68,842,106 D561E probably benign Het
Usp53 T A 3: 122,964,286 Q69L probably benign Het
Other mutations in Sfxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Sfxn1 APN 13 54093916 missense probably benign
IGL01775:Sfxn1 APN 13 54105739 splice site probably benign
IGL02536:Sfxn1 APN 13 54085494 missense probably benign
R1467:Sfxn1 UTSW 13 54093871 missense possibly damaging 0.75
R1467:Sfxn1 UTSW 13 54093871 missense possibly damaging 0.75
R1468:Sfxn1 UTSW 13 54085627 splice site probably null
R1468:Sfxn1 UTSW 13 54085627 splice site probably null
R1476:Sfxn1 UTSW 13 54092450 critical splice donor site probably null
R1931:Sfxn1 UTSW 13 54093933 missense probably damaging 0.96
R2224:Sfxn1 UTSW 13 54085517 missense possibly damaging 0.96
R2225:Sfxn1 UTSW 13 54085517 missense possibly damaging 0.96
R2226:Sfxn1 UTSW 13 54085517 missense possibly damaging 0.96
R2288:Sfxn1 UTSW 13 54093957 missense probably benign 0.37
R4655:Sfxn1 UTSW 13 54092438 missense probably benign 0.14
R4989:Sfxn1 UTSW 13 54088914 missense probably benign 0.14
R5064:Sfxn1 UTSW 13 54085569 missense probably benign 0.05
R5950:Sfxn1 UTSW 13 54091287 missense probably benign 0.05
R6046:Sfxn1 UTSW 13 54088942 missense probably benign 0.14
R6170:Sfxn1 UTSW 13 54106507 missense probably benign 0.16
R6267:Sfxn1 UTSW 13 54093880 missense probably benign 0.03
R6296:Sfxn1 UTSW 13 54093880 missense probably benign 0.03
R6322:Sfxn1 UTSW 13 54104850 missense possibly damaging 0.66
R6500:Sfxn1 UTSW 13 54088899 missense probably benign
R6719:Sfxn1 UTSW 13 54106564 missense probably benign
R7629:Sfxn1 UTSW 13 54093022 missense probably damaging 1.00
R7814:Sfxn1 UTSW 13 54091231 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATTGTCACTGTATGTCCTTGC -3'
(R):5'- TAGAGACACACCTCTGCTTCGG -3'

Sequencing Primer
(F):5'- CTGTATGTCCTTGCCAGAGATACAG -3'
(R):5'- GCTTCGGCCCACTTCAGTAAG -3'
Posted On2018-06-22